Friday, 30 September 2011

Counting sequences with Unix tools

Every command line bioinformatician has a suite of specific utility tools in their $PATH for doing core operations on common data files, such as counting the number of sequences in a .fasta file. Sometimes however, you end up on someone else's server where those tools are no longer available. It's in this situation when a good working knowledge of the standard Unix tools can be valuable. Here's a short list of the most useful ones for chaining together:

  • cat - show
  • grep - filter
  • sed - modify
  • wc - count
  • cut - extract columns
  • sort - sort
  • uniq - identify duplicates
  • head - extract start
  • tail - extract end
  • expr - arithmetic
For example, the classic example is to count the number of sequences in a .fasta file:

% grep '>' in.fasta | wc -l

Because each sequence has a ">" character for its ID line, the grep selects out all the ID lines, which the number of is equal to the number of sequences. The wc command counts its input, and -l means to count lines, rather than characters or words.

Most of us would be using modern GNU/Unix systems, where the grep command has a -c option which counts matching lines rather than printing them out one by one, removing the need for wc:

% grep -c '>' in.fasta

Please ensure you use quote characters around the ">", otherwise the shell will think you want to send the output of grep to in.fasta, which will result in in.fasta being truncated to a zero length file. Not ideal.

More commonly today is the .fastq file, used for storing millions of short reads from high-throughput sequencing machines. An example of one entry is shown below:

@HWUSI-EAS-100R_0002:7:1:2596:12829#ACAGTG/1
TCAAAAATCAGCCGTCACCGAGTATTACCTGAATCACGGCAAATGGCCGGAAAACAC
+HWUSI-EAS-100R_0002:7:1:2596:12829#ACAGTG/1
ffffffffffdfffedaddbaa\ba\Yb`]_a`a```_^`_]YT\Q`]]TT]^BBBB

At first glance, the simplest way to count entries in a .fastq file would be to just extend what we did with .fasta files, but use the "@" character for the ID line matching.

% grep -c '@' in.fastq

Unfortunately, this doesn't always work, as "@" is also a valid symbol in the encoded quality string! No worries, let's use the "+" character on the second ID line. Arrggh, it's also a valid quality symbol! WTF? At this stage you start muttering expletives about moron file format designers, but then calm down when you realise it could have been much worse ie. XML.

Technically, the sequence and quality parts of a .fastq entry can span multiple lines, just like you see 60 column wrapped .fasta files. However, most vendors stick to 4 lines per entry, putting the sequence and quality strings on a single line each. This means we can count entries by dividing the number of lines in the file by four:

% LINES=`cat in.fasta | wc -l`
% READS=`expr $LINES / 4`
% echo $READS

The above is traditional Bourne shell, but most people are using modern-ish shells like BASH, where this can be written more concisely as:

% expr $(cat in.fasta | wc -l) / 4

That's it for now. More posts to follow.


5 comments:

  1. Thumbs up for the blog.. It really helped.
    btw is it in.fastQ instead of in.fasta in the line "% grep -c '@' in.fasta" ?

    ReplyDelete
    Replies
    1. Yes you are correct! I will fix the error. Thank you.

      Delete
  2. fine, if you've more unix command for manipuling NGS data, please you post it.

    ReplyDelete
  3. Hi, I find reading this article a joy. It is extremely helpful and interesting and very much looking forward to reading more of your work.. view

    ReplyDelete

  4. Legitimate Crypto Recovery Services - Go to ALPHA RECOVERY EXPERTS

    Alpha Recovery Experts has built a reputation for providing specialized cybersecurity and ethical hacking services aimed at helping clients address complex digital asset challenges. One of the key factors that sets Alpha Recovery Experts apart is its focus on ethical hacking methodologies. Ethical hacking involves the use of authorized security techniques to identify vulnerabilities, investigate incidents, and support recovery efforts while adhering to legal and professional standards. By combining technical expertise with a structured investigative approach, the company works to assist clients in understanding what happened to their digital assets and what recovery options may be available.

    In addition to recovery services, Alpha Recovery Experts emphasizes cybersecurity awareness and risk mitigation. The company recognizes that preventing future incidents is just as important as addressing existing problems. Through security assessments, best-practice recommendations, and educational guidance, clients can gain valuable insights into protecting their cryptocurrency wallets, accounts, and sensitive digital information from evolving cyber threats.

    For individuals and organizations seeking support with cryptocurrency-related security concerns, the company positions itself as a resource focused on technical expertise, ethical practices, and client-centered solutions.

    WhatsApp; +44(745)742-4681
    Email: (Alpharecoveryexpert@consultant.com)

    ReplyDelete