tag:blogger.com,1999:blog-10716614344735595892024-03-19T13:22:17.993+11:00The Genome FactoryBioinformatics tips, tricks, tools and commentary with a microbial genomics bent. Written by Torsten Seemann from Melbourne, Australia.Torsten Seemannhttp://www.blogger.com/profile/12241185247897084810noreply@blogger.comBlogger32125tag:blogger.com,1999:blog-1071661434473559589.post-7586482276972994602022-05-31T12:17:00.005+10:002022-06-01T12:49:21.288+10:00How to perform a fresh Bioconda installation
<style>
BODY { font-family: sans-serif; }
PRE { background-color: LightGray; }
P { text-align: justify; }
</style>
<h3>Introduction</h3>
<p>
Conda has been revolutionary for
scientific software. For developers
it has made it simpler to package
their tools. HPC users have been
empowered to deploy software
without relying on the cluster administrators
to build new modules. For desktop users
it has made it simple to get the
tools they need installed without
the pain of the
"<tt>./configure && make && make install</tt>" cycle.
</p>
<p>
For those of us in the bioinformatics field,
<a href="https://bioconda.github.io/">Bioconda</a>
has done an amazing job in wrangling the huge
number of tools endlessly being published
and updated into a (mostly) seamless installtion process.
However, things do go wrong occasionally.
Sometimes is the fault of Conda or Bioconda,
but sometimes it's just a mangled installation
which is best handled by a "nuke and rebuild" strategy.
This post will show you how to do it properly.
</p>
<h2>1. Seek</h2>
<p>Firt we need to find where you installed conda previously.
Normally this will be <tt>~/miniconda3</tt> in your home folder.
You can determine via one of the methods below.
<pre>
% conda activate base
% echo $CONDA_PREFIX
/home/tseemann/miniconda3
% whch conda
~/miniconda/bin/conda
</pre>
<h2>2. Destroy</h2>
<pre>
% conda deactivate
% rm -f ~/.condarc
% rm -fr ~/.conda
# replace this folder if needed from Step 1
% rm -fr ~/miniconda3
</pre>
<h2>3. Rebuild</h2>
<pre>
% cd $HOME
# donwload the installer
% curl -O https://repo.anaconda.com/miniconda/Miniconda3-latest-Linux-x86_64.sh
# add "-b" if you want to skip all the questions
% sh ./Miniconda3-latest-Linux-x86_64.sh
</pre>
<h2>4. Get your channels in order</h2>
<p>This is a very important step that many
users don't do. The order is critical
to avoid weird dependency failures later.
</p>
<pre>
% conda config --add channels defaults
% conda config --add channels bioconda
% conda config --add channels conda-forge
</pre>
<h2>5. Install mamba</h2>
<p>The conda command can often take
a very long time to resolve dependencies.<br>
An alternative is <tt>mamba</tt>
which is a (mostly) drop in replacement
for the <tt>conda</tt> command which
is much faster.
</p>
<pre>
% conda install mamba -y
% mamba --version
mamba 0.15.3
conda 4.12.0
</pre>
<h2>6. Use mamba of conda for installs</h2>
<pre>
% mamba create -n torsryverse 'snppy==4.4.5' shovill abricate mlst prokka
% conda activate torstyverse
% snippy --version
snippy 4.4.5
</pre>
<h2>7. Add aliases</h2>
<p>
I personally get tired of typing
out <tt>conda activate</tt> and
<tt>conda deactivate</tt> so I have
aliases for them.
</p>
<pre>
# Append to ~/.bashrc login file
% echo "alias ca='conda activate'" >> ~/.bashrc
% echo "alias cda='conda deactivate'" >> ~/.bashrc
# log out and log back in
% ca torstyserse
% mlst --version
mlst 2.22.0
</pre>
<h2>Conclusion</h2>
<p>
Sometimes it is just better
to burn it all down and start again.
</p>
<h2>References</h3>
<ul>
<li><a href="https://bioconda.github.io/user/install.html">Bioconda install guide</a>
</ul>
Torsten Seemannhttp://www.blogger.com/profile/12241185247897084810noreply@blogger.com0tag:blogger.com,1999:blog-1071661434473559589.post-78949191740981636162019-09-09T16:06:00.001+10:002019-09-09T16:11:59.139+10:0025 reasons assemblies don't make it into Refseq<style type="text/css">
BODY { font-family: sans-serif; }
PRE { font-size: smaller; }
</style>
<h3>
Introduction</h3>
<p>
When you submit a genome assembly, or NCBI assembles the reads you submitted, it ends up in Genbank. If the assembly is of sufficient quality, it is annotated with PGAP and added to Refseq. Note that this means the same assembly can exist in Genbank (with your original annotation) and in Refseq with the PGAP annotation and a different accession number.
</p>
<p>There are many reasons why a Genbank assembly could be denied admission to Refseq, and here I outline how to find out if the genome you are working with is potentially bad, and why.
</p>
<h3>
Commands</h3>
<pre>wget https://ftp.ncbi.nlm.nih.gov/genomes/genbank/assembly_summary_genbank.txt
pip3 install csvkit
csvcut -t -K 1 -c 'excluded_from_refseq' assembly_summary_genbank.txt \
| tail -n +2 | tr ";" "\n" \
| sed -e 's/^ //' -e 's/ $//' | grep -v '""' \
| sort | uniq -c | sort -nr
</pre>
<h2>
Results</h2>
<pre> 198215 derived from surveillance project
32538 derived from metagenome
16820 derived from environmental source
10389 metagenome
4684 low contig N50
2187 partial
1822 many frameshifted proteins
1568 derived from single cell
856 genome length too large
820 genome length too small
752 high contig L50
562 low quality sequence
357 contaminated
352 missing tRNA genes
309 abnormal gene to sequence ratio
274 validation errors
194 missing ribosomal protein genes
114 missing rRNA genes
104 untrustworthy as type
77 unverified source organism
38 misassembled
12 mixed culture
6 chimeric
4 low gene count
2 hybrid
</pre>
<h3>Conclusion</h3>
<p>Stick to using genomes from Refseq wherever possible. The main exception may be if you are working in public health microbiology, then the "<i>derived from surveillance project"</i> reason probably means it is part of GenomeTrakr and might still be of importance.</p>
Torsten Seemannhttp://www.blogger.com/profile/12241185247897084810noreply@blogger.com88tag:blogger.com,1999:blog-1071661434473559589.post-59647560604497361452018-10-14T17:09:00.001+11:002018-10-16T11:11:38.738+11:00A Unix one-liner to call bacterial variants<style>
body {
font-family: sans-serif;
}
p {
text-align: justify;
padding-bottom: 1ex;
}
pre {
background: #EEEEEE;
padding: 1ex;
}
ul {
padding-bottom: 1ex;
}
h2, h3 {
padding-top: 1ex;
}
</style>
<h2>Introduction</h2>
<p>Variant finding is the generic term for finding differences between two genome sequences.
These differences can take many forms, such as
<a href="http://thegenomefactory.blogspot.com/2013/10/understanding-snps-and-indels-in.html">SNPs and small INDELs</a>,
large changes in DNA content caused by mobile elements,
and structural changes like chromosomal inversions.</p>
<p>The genomes we want to compare could either be assemblies (complete or draft) or just sequencing reads (FASTQ files).
The bulk of microbial variant finding tools focus on small differences (< 20 bp), and work by comparing a FASTQ sample
to a assembled genome, typically called the "reference". A common use case is to sequence your isolate of interest, and
see how it differs to the type strain in Genbank.</p>
<h2>Calling SNPs with a one-liner</h2>
<p>Let us assume we have a reference genome in FASTA format in the <tt>REF</tt> variable,
the paired Illumina FASTQ files in <tt>R1</tt> and <tt>R2</tt>, and the number of CPU
cores you want to use in <tt>CPUS</tt>. Then, the follow
"one-liner" will generate a VCF file with no intermediate files.</p>
<pre>CPUS=4
REF=ref.fa
R1=R1.fastq.gz
R2=R2.fastq.gz
minimap2 -a -x sr -t "$CPUS" "$REF" "$R1" "$R2" \
| samtools sort -l 0 --threads "$CPUS" \
| bcftools mpileup -Ou -B --min-MQ 60 -f "$REF" - \
| bcftools call -Ou -v -m - \
| bcftools norm -Ou -f "$REF" -d all - \
| bcftools filter -Ov -e 'QUAL<40 || DP<10 || GT!="1/1"'
> variants.vcf
</pre>
<p>
The reads are aligned to the reference, and sorted by coordinate. Instead of saving the BAM file,
we pipe it directly to a series of BCF tool steps. Note the use of <tt>-l 0</tt> and <tt>-Ou</tt>
to keep the piped data in an uncompressed form, to avoid repeated compression/decompression steps.
The <tt>--min-MQ 60</tt> ensures only uniquely mapped reads are used. The final <tt>filter</tt> step
removes low quality variant calls, heterzygous calls (this is haploid bacteria), and any regions
with less than 10 supporting reads.</p>
<p>Here is a summary of the results of this one-liner using some data for <i>Pasteurella multocida</i>.
You can download with these links:
<a href="ftp://ftp.ensemblgenomes.org/pub/bacteria/release-41/fasta/bacteria_0_collection/pasteurella_multocida_subsp_multocida_str_pm70/dna/Pasteurella_multocida_subsp_multocida_str_pm70.ASM682v1.dna.chromosome.Chromosome.fa.gz">REF (.fa.gz)</a>,
<a href="ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR412/009/SRR4124989/SRR4124989_1.fastq.gz">R1 (.fastq.gz)</a>
and
<a href="ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR412/009/SRR4124989/SRR4124989_2.fastq.gz">R2 (.fastq.gz)</a>.</p>
<pre>
bcftools stats variants.vcf | grep '^SN' | cut -f3-
number of samples: 1
number of records: 36618
number of no-ALTs: 0
number of SNPs: 36408
number of MNPs: 0
number of indels: 210
number of others: 0
number of multiallelic sites: 0
number of multiallelic SNP sites: 0
</pre>
<p>The one-liner found ~36,000 SNPs and 210 INDELs. </p>
<h2>Existing software</h2>
<p>This is not exhaustive list; just those I have encountered that are useful for <em>bacterial</em> data.</p>
<h3>Full pipelines</h3>
<p>
<ul>
<li><a href="https://github.com/tseemann/snippy#snippy">Snippy</a> - this is my pipeline
</li>
<li><a href="http://tgennorth.github.io/NASP/">NASP</a> - Northern Arizona SNP Pipeline
</li>
<li><a href="https://snp-pipeline.readthedocs.io/en/latest/">CFSAN SNP Pipeline</a> - used at CFSAN, FDA
</li>
<li><a href="https://github.com/lskatz/lyve-SET">LYVE-Set</a> - used at CDC
</li>
<li><a href="http://barricklab.org/twiki/bin/view/Lab/ToolsBacterialGenomeResequencing">Breseq</a> - Barrick Lab
</li>
<li><a href="https://github.com/dsarov/SPANDx">SPANDX</a> - Derek Saravoich and Erin Price
</li>
</ul>
</p>
<h3>Variant caller only</h3>
<p>
<ul>
<li><a href="http://dkoboldt.github.io/varscan/">VarScan</a> - Dan Koboldt
</li>
<li><a href="https://software.broadinstitute.org/gatk/">GATK</a> - The Broad Institute
</li>
<li><a href="https://github.com/ekg/freebayes">Freebayes</a> - Erik Garrison
</li>
<li><a href="http://csb5.github.io/lofreq/">Lofreq</a> - Andreas Wilm, Niranjan Nagarajan
</li>
<li><a href="http://samtools.github.io/bcftools/howtos/variant-calling.html">SAMtools/BCFtools</a> - The originals!
</li>
</ul>
</p>
<h2>Conclusion</h2>
<p>Variant calling in bacteria is both "easy" and "hard". If your sequencing data is high quality,
not contaminated, and came from a pure colony, then finding most of variants will be relatively easy.
The problems crop up when alignments aren't filtered correctly, reads are a mix of isolates, and
the reference is too divergent from the isolate.</p>
<p>I have made many mistakes in SNP calling over the years. My own pipeline
<a href="https://github.com/tseemann/snippy#snippy">Snippy</a>
is now at version 4.3 and I'm still not completely happy with its performance,
but it is "good enough" for its primary task
which is to generate core-genome SNP phylogenies and find
differences between mutants and wildtype in mutagenesis experiments.</p>
<p>Should you use the one-liner presented above?
Probably not - the various available SNP pipelines have done a lot of tuning
and offer extra useful features. However it is an excellent learning
opportunity to examine each of the steps involved and the parameters
that affect the output results.</p>
<p><i>It's always a trade-off between false positives and false negatives!</i></p>
<h2> Further reading</h2>
<ul>
<li><a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4493402/">Best practices for evaluating single nucleotide variant calling methods for microbial genomics</a>
</li>
</ul>
Torsten Seemannhttp://www.blogger.com/profile/12241185247897084810noreply@blogger.com9tag:blogger.com,1999:blog-1071661434473559589.post-34986947141715080622016-09-10T21:10:00.000+10:002016-09-10T21:10:48.923+10:00Manipulating big TSV files in the Unix terminal<STYLE>
BODY { font-family: sans-serif; }
P { text-justify: inter-word; text-align: justify; }
TABLE, TH, TD { border: 1px solid black; padding: 0.2em; }
TABLE { border-collapse: collapse; }
TH { background: LemonChiffon; font-weight: bold; text-align: left; }
PRE, TT, CODE { font-size: smaller; }
DIV.tsv {
font-size: smaller;
font-family: monospace;
background: WhiteSmoke;
}
</STYLE>
<h3>Introduction</h3>
<P>
Bioinformatics is full of plain text, machine readable file formats. One of my favourites is the
"<a href="https://en.wikipedia.org/wiki/Tab-separated_values">tab separated values</a>"
format (TSV). It's like the popular
"<a href="https://en.wikipedia.org/wiki/Comma-separated_values">comma separated values</a>"
format (CSV) but uses a <i>tab</i> instead of a <i>comma</i>. The main advantage of TSV over CSV is that you don't need to escape or quote your values when they have a comma in them, and many Unix tools for manipulating columnar data default to using <i>tab</i> as the field separator.
<P>
Some TSV files are huge - not just in rows, but also in columns. An important new TSV file for those who work in comparative genomics is the new NCBI <TT>assembly_summary.txt</TT> file. Here is the first 3 lines from the
<a href="ftp://ftp.ncbi.nlm.nih.gov/genomes/refseq/archaea/assembly_summary.txt">archaea summary file</a>:
<div class='tsv'>
% head -n 3 assembly_summary.txt
<p>
# See ftp://ftp.ncbi.nlm.nih.gov/genomes/README_assembly_summary.txt for a description of the columns in this file.
<br>
# assembly_accession bioproject biosample wgs_master refseq_category taxid species_taxid organism_name infraspecific_name isolate version_status assembly_level release_type genome_rep seq_rel_date asm_name submitter gbrs_paired_asm paired_asm_comp ftp_path excluded_from_refseq
<br>
GCF_000302455.1 PRJNA224116 SAMN02471940 AMPO00000000.1 representative genome 1204725 2162 Methanobacterium formicicum DSM 3637 strain=DSM 3637 latest Contig Major Full 2012/10/02 ASM30245v1 Deparment of Genetics, University of Seville, Spain GCA_000302455.1 identical ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF_000302455.1_ASM30245v1
</div>
<p>
It is not very clear what is what. At this point some people would load this into Excel, R or Pandas, and those
are perfectly fine. But if you need to write a portable pipeline script or are on an unfamiliar server you will
want to stick with common Unix tools.
<p>
The first problem is that the first line is <b>not</b> the column headers, but a pointer to some documentation.
Let's get rid of the first line:
<div class='tsv'>
% tail -n +2 assembly_summary.txt | head -n 3
<p>
# assembly_accession bioproject biosample wgs_master refseq_category taxid species_taxid organism_name infraspecific_name isolate version_status assembly_level release_type genome_rep seq_rel_date asm_name submitter gbrs_paired_asm paired_asm_comp ftp_path excluded_from_refseq
<br>
GCF_000302455.1 PRJNA224116 SAMN02471940 AMPO00000000.1 representative genome 1204725 2162 Methanobacterium formicicum DSM 3637 strain=DSM 3637 latest Contig Major Full 2012/10/02 ASM30245v1 Deparment of Genetics, University of Seville, Spain GCA_000302455.1 identical ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF_000302455.1_ASM30245v1
<br>
GCF_000762265.1 PRJNA224116 SAMN03085433 representative genome 2162 2162 Methanobacterium formicicum strain=BRM9 latest Complete Genome Major Full 2014/10/02 ASM76226v1 PGgRc GCA_000762265.1 identical ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF_000762265.1_ASM76226v1
</div>
<h3>Viewing</h3>
<p>It's still confusing because the rows are wider than the terminal and are wrapping. We can turn wrapping off in the <tt>less</tt> file viewer woth the <tt>-S</tt> option, and even <b>use the left and right cursor keys to pan left and right</b>!
<div class='tsv'>
% tail -n +2 assembly_summary.txt | less -S
<p>
# assembly_accession bioproject biosample wgs_master refseq_category t
<br>
GCF_000302455.1 PRJNA224116 SAMN02471940 AMPO00000000.1 representative
<br>
GCF_000762265.1 PRJNA224116 SAMN03085433 representative genome 2162 2
<br>
...
</div>
<p>
The horizontal scrolling within the terminal is very useful, but the columns still don't line up.
Of course, there is already a Unix tool called <tt>column</tt> to help! This will examine all the data
and convert each tab into a different number of spaces to make everything line up like a spreadsheet.
<div class='tsv'>
% tail -n +2 assembly_summary.txt | column -t | less -S
<p>
# assembly_accession bioproject biosample
<br>
GCF_000302455.1 PRJNA224116 SAMN02471940 AMPO00000000.1
<br>
GCF_000762265.1 PRJNA224116 SAMN03085433 representative
<br>
...
</div>
<h3>Manipulating</h3>
<p>
Okay, so this is very useful for looking at wide TSV files, but what if I want to select particular columns with <tt>cut</tt> and <tt>sort</tt>? How do I know which column to cut? Well, we can use some standard Unix tools to do this magic:
<pre>
% tail -n +2 assembly_summary.txt | head -n 1 | tr "\t" "\n" | nl
1 # assembly_accession
2 bioproject
3 biosample
4 wgs_master
5 refseq_category
6 taxid
7 species_taxid
8 organism_name
9 infraspecific_name
10 isolate
11 version_status
12 assembly_level
13 release_type
14 genome_rep
15 seq_rel_date
16 asm_name
17 submitter
18 gbrs_paired_asm
19 paired_asm_comp
20 ftp_path
21 excluded_from_refseq
</pre>
<p>
This is how it works:
<ol>
<li> <tt>tail -n +2</tt> skips over the first junk line
<li> <tt>head -n 1</tt> keeps the first line only (which is the TSV header line)
<li> <tt>tr</tt> converts the <i>tab</i> characters to <i>newline</i> characters to turn columns into rows
<li> <tt>nl</tt> is a little known Unix command which adds line numbers
</ol>
if you have zero-based columns, you can use <tt>nl -v 0</tt> instead - type <tt>man nl</tt> for more details.
<p>
You can then cut and sort with ease! For example, this one-liner lists the top 10 Archaeal genome assemblies available in Genbank:
<pre>
% tail -n +3 assembly_summary.txt | cut -f8 | sort | uniq -c | sort -nr | head -n 10
56 Methanosarcina mazei
46 Sulfolobus acidocaldarius
6 Metallosphaera sedula
4 Sulfolobus solfataricus
3 Methanobacterium formicicum
3 Haloferax mediterranei ATCC 33500
3 Halalkalicoccus jeotgali B3
2 Sulfolobus solfataricus 98/2
2 Natronorubrum tibetense GA33
2 Natronobacterium gregoryi SP2
</pre>
<h3>Conclusion</h3>
<p>
If you need to do more advanced things in the shell, here are 3 excellent command line tools
specifically designed to manipulate TSV files:
<ul>
<li><a href="https://www.gnu.org/software/datamash">Datamash</a>
<li><a href="https://github.com/lh3/tabtk">tabtk</a>
<li><a href="http://johnkerl.org/miller/doc/index.html">Miller</a>
</ul>
<p>
If this post has stopped at least one person resorting to Excel unnecessarily, then it was worth it.
Torsten Seemannhttp://www.blogger.com/profile/12241185247897084810noreply@blogger.com18tag:blogger.com,1999:blog-1071661434473559589.post-2008737940049462642016-04-11T21:03:00.000+10:002016-04-11T21:03:53.792+10:00What bacterial genome assemblers are people using?<STYLE>
BODY { font-family: sans-serif; }
P { text-justify: inter-word; text-align: justify; }
TABLE, TH, TD { border: 1px solid black; padding: 0.2em; }
TABLE { border-collapse: collapse; }
TH { background: LemonChiffon; font-weight: bold; text-align: left; }
PRE, TT { font-size: smaller; }
PRE { background: WhiteSmoke; }
</STYLE>
<H2>Introduction</H2>
<P>
As of April 2016, there are about 70,000 genome assemblies in Genbank (draft and complete), with the majority being bacterial genomes. For genomes that have been submitted in NGS era, the <TT>COMMENT</TT> section of the Genbank file header has machine readable information about the sequencing technology, depth of coverage, and software used.
<P>
For example, the entry for <A HREF="http://www.ncbi.nlm.nih.gov/nuccore/514934154/?report=genbank"><I>Enterococcus faecium OC2A-1</I></A> contains this:
<PRE>
##Genome-Assembly-Data-START##
Finishing Goal :: High-Quality Draft
Current Finishing Status :: High-Quality Draft
Assembly Method :: Velvet v. 1.1.06
Genome Coverage :: 104x
Sequencing Technology :: Illumina
##Genome-Assembly-Data-END##
</PRE>
<H2>Method</H2>
<P>
I decided to parse this header for all the bacterial <TT>.gbff.gz</TT> (GenBank File Format, aka <TT>.gbk</TT>) files available at NCBI FTP to see what genome assembly software is being used for bacterial genomes. Now, like any user provided information, there is a lot of junk in this field, so I wrote some curated regexps to categorise them into cleaner bins. If more than one method was listed, I binned into <I>Hybrid/Mixed</I>. If if it was too minor or probably wrong I binned as <I>Could not parse</I>.
<H2>Results</H2>
<P>
<TABLE>
<TR><TH>Count<TH>Assembler Software
<TR><TD>23725<TD><I>Not provided</I>
<TR><TD>9883<TD>AllPaths
<TR><TD>5325<TD>Newbler
<TR><TD>3783<TD>Velvet
<TR><TD>3585<TD>CLC Genomics Workbench
<TR><TD>3347<TD>Spades
<TR><TD>2610<TD>IDBA
<TR><TD>2477<TD>Celera Assembler
<TR><TD>2082<TD>ABYSS
<TR><TD>1815<TD>CLC NGS Cell
<TR><TD>1782<TD>SOAPdenovo
<TR><TD>1370<TD><I>Could not parse</I>
<TR><TD>1119<TD>HGAP
<TR><TD>870<TD>MaSuRCA
<TR><TD>853<TD>MIRA
<TR><TD>793<TD>A5-MiSeq
<TR><TD>308<TD>Ray
<TR><TD>149<TD>Phred/Phrap/Consed
<TR><TD>132<TD>Geneious
<TR><TD>110<TD>SeqMan
<TR><TD>109<TD>HGAP3
<TR><TD>98<TD>Edena
<TR><TD>69<TD>Hybrid/Mixed
<TR><TD>59<TD>DNAstar
<TR><TD>55<TD>Platanus
<TR><TD>53<TD>NextGene
<TR><TD>20<TD>Arachne
<TR><TD>19<TD>DISCOVAR
<TR><TD>9<TD>VelvetOptimiser
<TR><TD>5<TD>Falcon
<TR><TD>4<TD>Megahit
<TR><TH>66618<TH>Total
</TABLE>
<P>
<H2>Discussion</H2>
<P>
I was a little surprised to see ALLPATHS top the list due to its particular requirements for DNA library construction (overlapping PE + long mate pair), but the Broad Institute does do a lot of sequencing. A lot of people are using Velvet and Spades, but equal many using CLC Workbench or the NGS Cell product.
<P>
The most disturbing and funniest entries in the <I>Could not parse</I> division are listed below.
<P>
<PRE>
in-house software v. 10/18/2012
Unknown program v. before 2013-07-02
Direct Sequencing
DNASTAR SeqMan NGen v. 4.0.0
GS Reference Mapper v. September 2013
Trimmomatic v. 0.32;
Ion Torrent PGM
Artimis v. 10.1
artimist v. 10.1
De Bruijn graph v. Apr-2011
BCFtools Consensus
BLASTN v. actual
BOWTIE v. Version 2.1.0
BWA v. 0.5.1
BioNumerics v. 6.6
ELAND alignment algorithm
Galaxy v. May 2012
de Bruijn graphs v. Mar-2013
MAQ v. 0.7.1
MATLAB v. R2013a
</PRE>
<P>
At the top we have <TT>in-house software</TT> (with a version number!). The <TT>Direct Sequencing</TT> could be a single perfect read of full chromosome from a <I>really</I> lucky Oxford Nanopore user. Is there anything <TT>Artimist</TT> (aka Artemis) cannot do? I need to upgrade my version of <TT>Trimmomatic</TT> and <TT>"actual" BLASTN</TT> too.
<H2>Conclusion</H2>
<P>
My main concern is the number of read aligners listed. There are some draft genomes myself and others have encountered where it appears the submitters have just aligned the reads to a close reference and submitted the consensus sequence as the assembly. These "genomes" sometimes cause problems in population studies, and I'd rather the reads be available instead.
Torsten Seemannhttp://www.blogger.com/profile/12241185247897084810noreply@blogger.com11tag:blogger.com,1999:blog-1071661434473559589.post-13025932578290009722015-10-04T07:02:00.001+11:002015-10-04T07:02:48.536+11:00ASM NGS 2015 - Meeting Notes<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="font-family: Arial; font-size: 14.6667px; text-align: justify; vertical-align: baseline; white-space: pre-wrap;"><br /></span></div>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="font-family: Arial; font-size: 14.6667px; text-align: justify; vertical-align: baseline; white-space: pre-wrap;">These notes were taken during</span><span style="font-family: Arial; font-size: 14.6667px; font-style: italic; text-align: justify; vertical-align: baseline; white-space: pre-wrap;"> the </span><span style="color: #1155cc; font-family: Arial; font-size: 14.6667px; line-height: 22.08px; text-align: justify; text-decoration: underline; vertical-align: baseline; white-space: pre-wrap;"><a href="http://conferences.asm.org/index.php/component/content/article/122-conferences/2015-rapid-ngs-bioinformatic-pipelines-for-enhanced-molecular-epidemiologic-investigation-of-pathogens/251-conference-scope" style="line-height: 22.08px; text-decoration: none;" target="_blank">1st ASM Conference on 2015 Rapid NGS Bioinformatic Pipelines for Enhanced Molecular Epidemiologic Investigation of Pathogens</a></span><span style="font-family: Arial; font-size: 14.6667px; font-style: italic; text-align: justify; vertical-align: baseline; white-space: pre-wrap;"> </span><span style="font-family: Arial; font-size: 14.6667px; text-align: justify; vertical-align: baseline; white-space: pre-wrap;">held at the Omni Shoreham Hotel in Washington DC, USA from 24-27 September 2015. The conference has the shorter nickname “ASM NGS” and used the Twitter hashtag <a href="https://twitter.com/search?f=tweets&vertical=default&q=%23asmngs&src=typd" target="_blank">#ASMNGS</a>.</span></div>
<b id="docs-internal-guid-479d6aa0-2f43-1a7d-3b51-a637d285f3a0" style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt; text-align: justify;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">The notes are intended to be as objective as possible. Personal opinions or speculation are prefixed by the author’s initials below:</span></div>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="font-family: Arial; font-size: 14.6667px; list-style-type: disc; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="font-size: 14.6667px; vertical-align: baseline; white-space: pre-wrap;">PA = Phil Ashton (Public Health England, UK) = </span><a href="https://twitter.com/flashton2003" style="font-size: 14.6667px; line-height: 20.24px; white-space: pre-wrap;" target="_blank">@flashton2003</a></div>
</li>
<li dir="ltr" style="font-family: Arial; font-size: 14.6667px; list-style-type: disc; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="font-size: 14.6667px; vertical-align: baseline; white-space: pre-wrap;">TS = Torsten Seemann (Uni. Melbourne, Australia) = <a href="https://twitter.com/torstenseemann" target="_blank">@torstenseemann</a></span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="font-size: 14.6667px; line-height: 1.38; white-space: pre-wrap;">FB = Fiona Brinkman (Simon Fraser University, Canada) = </span><a href="https://twitter.com/fionabrinkman" style="font-size: 14.6667px; line-height: 20.24px; white-space: pre-wrap;" target="_blank">@fionabrinkman</a></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">EG = Emma Griffiths (Simon Fraser University, Canada) = </span><a href="https://twitter.com/griffiemma" style="font-size: 14.6667px; line-height: 20.24px; white-space: pre-wrap;" target="_blank">@griffiemma</a></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">RL = Robyn Lee (McGill University, Canada) = </span><a href="https://twitter.com/robyn_s_lee" style="font-size: 14.6667px; line-height: 20.24px; white-space: pre-wrap;" target="_blank">@robyn_s_lee</a></div>
</li>
</ul>
<br />
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"></span></div>
<hr />
<b style="font-weight: normal;"><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Steve Musser - FDA (session chair)</span></b><br />
<br />
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Welcome remarks by Joseph Campos, Gary Procop, Eric Brown</span></div>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"></span></div>
<hr />
<b style="font-weight: normal;"><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">George Weinstock - Jackson Labs</span></b><br />
<br />
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: italic; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Microbial Genomics and Beyond</span></div>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Applications of clinical microbial NGS</span></div>
</li>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">eg surge of O157:H7 outbreaks in St. Louis → salad bar at grocery chain</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">core genome O157 - 3.4 million nts (Leopold, 2009; see diagram of SNPs showing evolution)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">eg Bacteremia in NICU (from diapers) → monitoring babies in real time with WGS, “identity” of culprits of infection found in gut microbiome, 101 spp sufficiently covered from stool samples to assess SNPs depending on tissue, sample site etc produce different spectrum of AMR genes</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">eg Daptomycin resistance via mutation, in Enterococcus</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Daptomycin used for patients with VRE</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">mutations in GdpD, Cls, LiaF produce resistance, can profile in patients</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">eg estimating bla copies (compared to single copy MLST genes), not in plasmids but massive tandem array</span></div>
</li>
</ul>
</ul>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Metagenomics examples</span></div>
<ol style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: decimal; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">virus detection by metagenomics (febrile children study)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: decimal; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">mWGS vs RNA-Seq (looking for “Golden Microbiome” in elite athletes); mWGS=1% Methanobrevibacter (Archaea), RNA-Seq (48% Methanobrevibacter) → transcription may be more important than looking at “who’s there”</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: decimal; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">16S amplicon seq, cheaper, faster, high throughput, more comprehensive than PCR, culture</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: decimal; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Pathogen Detection - hospital acquired diarrhea, pathogen abundance in clinical samples, acne associated skin microbiome (top 10 ribotypes differ by 1-2 SNPs, wouldn’t have detected these unless seq entire 16S gene)</span></div>
</li>
</ol>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Read Length distance: PacBio, full length 16S (Fichot & Norman, Microbiome, 2013, 1:10)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Finding long read full-length amplicon sequencing for microbiome analysis works. Yeay! (PacBio Nanopore)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">10x coverage, 5x around circle</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">single organisms, polymorphisms in multiple copies</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">benchmarking 16S with MinION</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">HMP req’s metagenomic benchmarking</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">BLAST takes a long time to perform, rate limiting step in real time investigations, few tweaks were able to increase speed 10x (Big Iron NCSA Blue Waters, TeraGrid) </span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /><br /></b><br />
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"></span></div>
<hr />
<b style="font-weight: normal;"><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Lynn Bry - Brigham Women’s Hospital </span></b><br />
<br />
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: italic; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">(Late replacement for Julian Parkhill)</span></div>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Sequencing foodborne and MDR clinical isolates at BWH.</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">1000 micro samples per day! >100 +ve cultures across kingdoms/phyla</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">50% diagnosis, 10% therapy, 40% screening/surveillance MRSA, VRE, GrpB Strep, Gram-</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Lots of metadata: MIC, disk diff, E-TEST, Drug resistance, zone diam, R/I.S, ESBL, D-zone CLI/ERM</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">HIPAA de-identified data - Year only, no location</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">WHONET </span><a href="http://whonet.org/" style="text-decoration: none;"><span style="background-color: transparent; color: #1155cc; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: underline; vertical-align: baseline; white-space: pre-wrap;">http://whonet.org/</span></a><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"> open source to generate antiobiograms in surveillance (Old, Windows s.w)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Crimson LIMS - prospective analysis of clinical samples & real time query</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">“Honest Broker” assigns new external IDs</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Spades, QUAST, ResFinder, CARD, RAST, Mauve for extra chromosomal, BLAST for plasmid/transposon, where is the resistance gene ? transposon - plasmid or chrom.</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">SNPS: bowtie2, mpileup, bcftools, custom filtering.</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Kp CRE ST258 - found many different plasmids and transposons + point mutations - WGS revealed this detail</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">E. cloacae CRE - ampC on chrom + porin mutations , multiple mobile elements Tn4401b / Tn6901</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: white; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Serratia marcessens</span><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"> CRE - SRT-2 Ampc_SME-4, AmpC and KPC-3 acquire, 3 year survey 2011-2014, 2 close events</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">TImelimes; MiSeq (14 days), Bioinformatics (1 - 14 days), Epi (14 days)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Despite 3 week turnaround they are told it IS actionable</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Rule out just as important as rule in</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Mobile element analysis can refine relationship analysis</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Curating new genomes and mobile elements takes the most the time</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Desire to use more principled methods for outbreak calling - SaTScan, Bayesian, likelihoods</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"></span></div>
<hr />
<b style="font-weight: normal;"><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Stephen Ostroff</span></b><br />
<br />
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: italic; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Priming the Innovation Pump: FDA’s Role in Advancing and Using NGS</span></div>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Did not use any slides.</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Was FDA employee #1</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">WGS - gamechanger for “splitters”</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">WGS Identifies previously unknown clusters, provides surveillance/warning system</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">WGS allows rapid sharing between Ag, food, vet communities → evidence-based traceback and risk factors for identifying risks in food supply for targeted interventions</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">eg Foods Program</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">WGA→ routine analysis allowing for automation</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Provides lot of data relatively quickly</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">identifying stable genetic changes used to pinpoint contamination (genome provides 3-5 million data points/isolate; statistically robust, accurate and stable)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">WGS has allowed cases to be solved that were unresolvable by epi investigations alone</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">WGS useful for identifying medical agents, drug discovery, druggable targets (targets), live virus vaccine database identifying most prevalent strains</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">WGS is agnostic, don’t need to know identity of organism before sequencing → although sensitivity becomes an issue</span></div>
</li>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">eg ensure safety of blood supply with HIV detection tests and variant identification</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">eg cystic fibrosis test</span></div>
</li>
</ul>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">FDA collaborates with NIST (National Institute of Standards and Technology) to develop standards, need comprehensive repositories and sharing</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">GenomeTrakr (14 states and 9 regional labs)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">NARMS - National AMR surveillance (meat, animal slaughter, human samples) → real time monitoring of drug and disinfectant resistance determinants </span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"></span></div>
<hr />
<b style="font-weight: normal;"><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Marc Allard - FDA</span></b><br />
<br />
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: italic; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">GenomeTrakr: A Pathogen Database to Build a Global Genomic Network for PAthogen Traceback and Outbreak Detection</span><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"> </span></div>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">ref database: pathogen detection pipeline that can inform:</span></div>
<ol style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: decimal; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">matching food/enviro isolates to clinical</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: decimal; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">track facility contamination</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: decimal; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">trace source of contamination (DB contains isolates from different geo_locs)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: decimal; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">monitor AMR, virulence, pathogenicity </span></div>
</li>
</ol>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">GenomeTrakr project - originally sold as PulseNet 2.0 using WGS</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">No surprise that 4.7 Mbp gives higher resolution that a few antigen genes</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Source tracking is key application for WGS - statistically robust, high res, stable, accurate</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">FDA - genomics mapping, link between food & env & clinical</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">CDC - which clinical case inclusion / exclusion</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">FDA/CVM - antimicrobial resistance, phenotypic predictions from genotype</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Showed some GIS phylogeograph - made by </span><a href="http://www.supermap.com/en/html/products.html" style="text-decoration: none;"><span style="background-color: transparent; color: #1155cc; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: underline; vertical-align: baseline; white-space: pre-wrap;">http://www.supermap.com/en/html/products.html</span></a></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Minimal pathogen metadata</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">eg spicy tuna outbreak, Salmonella Bareilly</span></div>
</li>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">common PFGE patterns worldwide, not enough resolving power for inspectors to investigate (also sushi has many ingredients→ geo_loc details could help refine which ingredient is the culprit resulting in earlier intervention)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">SNP phylogeny identified Scrape Tuna (Indian isolates), cluster within 2-5 SNPs, phylogeographic analysis → tips of phylo trees mapped to India, 8km between location of sequenced isolate and source of food contamination</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">need for global DB for detecting leads like this</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<a href="https://jid.oxfordjournals.org/content/early/2015/06/25/infdis.jiv297.full" style="text-decoration: none;"><span style="background-color: transparent; color: #1155cc; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: underline; vertical-align: baseline; white-space: pre-wrap;">paper</span></a></div>
</li>
</ul>
</ul>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">eg S. Braenderup: Nut butter</span></div>
</li>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">outbreak cluster → only few SNP diffs</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">tree helped inform epi questionnaire = tool for IDing matches to drill down into number of cases faster (can point to particular foods from matching isolates)</span></div>
</li>
</ul>
</ul>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">as price for sequencing drops, number of isolates that can be sequenced increases</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">2015-15 was big year for WGS (rolled out in 2014; 2015 focus on standards, training and proficiency)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">250 isolates/week, detecting 24 clusters/week, subset of clusters are actionable → weekly meetings to make PH decisions based on this info</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">regular epi curve shows spike in illnesses occurs 20-48 days into outbreak, WGS will help get ahead of the epi curve to avert illness</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">minimal metadata (describing who, what, when, why) provides context, key to real-time investigations, better metadata contributes to earlier interventions (industry, growers, distributors) → identify certain suppliers with contamination, also resident vs transient pathogens (require different interventions)</span></div>
</li>
</ul>
<ol style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: decimal; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">reduced # recalls</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: decimal; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">decrease sick patients</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: decimal; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">preserves brand names</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: decimal; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">improved farm practices (packing/processing)</span></div>
</li>
</ol>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">PFGE with poorer resolution can falsely implicate industries</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">multi-ingredient products → can tease out endemic vs globally imported ingredient</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">industry needs access to data in 1-2 weeks to be effective</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">industries can use NCBI Genome Workbench, FDA analysis software themselves so the gov’t aren’t seen as “bad guys”, industry can understand the problems themselves</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Validation efforts:</span></div>
<ol style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: decimal; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">technical performance</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: decimal; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">intralab variation, seq platform</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: decimal; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">interlab</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: decimal; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">bioinformatics pipeline</span></div>
</li>
</ol>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"></span></div>
<hr />
<b style="font-weight: normal;"><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Frank M. Aerestrup - DTU, Denmark</span></b><br />
<br />
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: italic; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">GMI - GLobal Microbial Identifier - Dream or Future?</span></div>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Reviewing </span><a href="http://www.globalmicrobialidentifier.org/" style="text-decoration: none;"><span style="background-color: transparent; color: #1155cc; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: underline; vertical-align: baseline; white-space: pre-wrap;">http://www.globalmicrobialidentifier.org/</span></a><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"> </span></div>
</li>
<li dir="ltr" style="background-color: #fcfcfc; color: #292f33; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: #fcfcfc; color: #292f33; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Using the Battle of Austerlitz as a metaphor for WGS as a "common language" in our "war" </span></div>
</li>
<li dir="ltr" style="background-color: #fcfcfc; color: #292f33; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: #fcfcfc; color: #292f33; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Infectious diseases is still #1 problem - 25% of global deaths</span></div>
</li>
<li dir="ltr" style="background-color: #fcfcfc; color: #292f33; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: #fcfcfc; color: #292f33; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Increasingly they have </span><span style="background-color: #fcfcfc; color: #292f33; font-family: Arial; font-size: 14.666666666666666px; font-style: italic; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">global </span><span style="background-color: #fcfcfc; color: #292f33; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">epidemiology</span></div>
</li>
<li dir="ltr" style="background-color: #fcfcfc; color: #292f33; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: #fcfcfc; color: #292f33; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Real-time surveillance can’t work without real-time data sharing</span></div>
</li>
<li dir="ltr" style="background-color: #fcfcfc; color: #292f33; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: #fcfcfc; color: #292f33; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Much easier to teach genome sequencing than teaching Salmonella serotyping! (apart from more people who know serotyping in a typical micro lab!)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: #292f33; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: #292f33; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Need to get people to trust to share. </span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">FB: I think its key to encourage sharing first with v minimal metadata. Get everyone comfortable. Then more metadata can be added by those more comfortable and others will follow as they see the great benefit of doing so…</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: #292f33; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: #292f33; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Need to engage people more widely around the world.</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: #292f33; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: #292f33; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">TS: This talk needs to be taken in context of Marc Allard politely imploring DTU to put all their data in GenomeTrakr, with the implication that they are holding stuff back? FB: There is a culture of some people v worried about sharing that needs to be overcome. Hopefully now that Genometrakr has shown you can do it without getting sued, this will change. TS: I don’t think it is legal worries, i still think it is publication novelty fear (which is reasonable given worsening academic funding in most countries where papers are key metric)</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"></span></div>
<hr />
<b style="font-weight: normal;"><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Marianne Kjeldsen - Statens Serum Institut, Copenhagen, DENMARK</span></b><br />
<br />
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Three Months of Surveillance of S. Typhimurium+S. 4, 5, 12:i:- (aka monophasic typhimurium) in Denmark Based on WGS and MLVA Typing</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Salmonella 93.8M cases, 2500 serovars, 17% are serovar Typhimurium (notifiable)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">PA: ST36 < 2000 SNPs from ST19/ST34, hmm, would be surprised, as different clonal complex</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">SNP trees included strains that were excluded based on MLVA, but broadly concurrent.</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Higher discrimination than MLVA, especially for the monophasic ST34 strains.</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Lessons:</span></div>
<ol style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: decimal; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">WGS provided higher resolution than MLVA</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: decimal; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">reliable for outbreak detection, even with single ref strain</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: decimal; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">need to consider max SNP difference</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: decimal; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">investigations will always need to consider epi data</span></div>
</li>
</ol>
<b style="font-weight: normal;"><br /></b><br />
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"></span></div>
<hr />
<b style="font-weight: normal;"><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Amy Gargis - CDC</span></b><br />
<br />
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: italic; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Assuring the Quality of Next-Generation Sequencing in Clinical and Public Health Laboratories</span></div>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Quality assurance, sequencing, lab developed tests, optimizing library prep per organism, DNA quality</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">One major issue is assuring quality of DNA extract</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Publication here </span><a href="http://www.nature.com/nbt/journal/v33/n7/extref/nbt.3237-S1.pdf" style="text-decoration: none;"><span style="background-color: transparent; color: #1155cc; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: underline; vertical-align: baseline; white-space: pre-wrap;">http://www.nature.com/nbt/journal/v33/n7/extref/nbt.3237-S1.pdf</span></a></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Have to lock down bioinfx pipelines for quality control/assurance - strong difference from bioinfx community attitudes (PA)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Another paper - specific to variant calling </span><a href="http://journal.frontiersin.org/article/10.3389/fgene.2015.00235/abstract" style="text-decoration: none;"><span style="background-color: transparent; color: #1155cc; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: underline; vertical-align: baseline; white-space: pre-wrap;">http://journal.frontiersin.org/article/10.3389/fgene.2015.00235/abstract</span></a></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">clinical setting - CLIA regulates clinical labs performing tests on patient specimens → return results, CLA ensures accurate results</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">This is not “exciting science” but an important part of public health genomics</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"></span></div>
<hr />
<b style="font-weight: normal;"><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Deborah Moine - Nestlé</span></b><br />
<br />
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: italic; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Long Reads Sequencing for Better Short Reads SNP Analysis</span></div>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Need to detect contamination</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">When ref genome very different from sample (high SNP diffs), increases non-mappable reads → risk of false positives</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">PacBio generates 20Kb libraries requiring no amplification (less bias)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">SMRT Cell, 250 000 nanowell → 1 DNA molecule/well</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">10% error (random) rate, de novo assembly HGAP</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">< 15Kb is short read → used to correct longest PacBio read → get 1 contig representing whole genome</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">1 contig 4.3 Mb, 245x coverage for Salmonella (Nestle) study</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">20Kb library, 2SMRT cells, 1.4 Gb after filtering</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">SNP analysis using new ref genome, low number of non-mapping reads</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Need to look at tree and SNP distance matrix</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Ref genomes generated:</span></div>
</li>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">21 Salmonella</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">5 Listeria</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">25 Cronobacter</span></div>
</li>
</ul>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">SNP analysis better on full length ref than draft</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"></span></div>
<hr />
<b style="font-weight: normal;"><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Roger Barrette; Plum Island Animal Disease Center (USDA/ APHIS)</span></b><br />
<br />
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: italic; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Subtractive-hybridization for Enrichment of Non-host Nucleic Acid for Improvement of Sequence-based Detection of Pathogens</span></div>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Rapid ion torrent sequencing of Flu from Swine, but 87% host dna</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">need to decrease library bias → enrichment technique</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Capture RNA oligonucleotide, biotinylated</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">isolate host RNA, fragments, ligation of biotinylated construct at 22oC, reverse transcription</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">RNAse treatment, pull out target cDNA (w/ negative beads)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Goal: decrease host, increase viral reads</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">“Background subtractive hybridization method” - decreased total reads, but higher proportion of pathogen-specific reads</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">eg Proof-of-principle → Foot & Mouth</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">454 preps enriched vs not (by subtractive method)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">34% genome covered with no enrichment vs 75% with enrichment</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">need a process to increase yields and automate</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Summary: this DNA:cDNA pulldown method works!</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">decrease library bias, increasing likelihood of agent discovery → critical for testing primary tissues </span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: italic; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: italic; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Costs Less than a 454 Jr run presumably :)</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"></span></div>
<hr />
<b style="font-weight: normal;"><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Catherine Yoshida; Public Health Agency of Canada, Guelph, ON, CANADA</span></b><br />
<br />
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: italic; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">The </span><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Salmonella in silico </span><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: italic; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Typing Resource (SISTR): Rapid Analysis of </span><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Salmonella</span><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: italic; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"> Draft Genome Sequence Data</span></div>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Salmonella in silico typing resource - </span><a href="https://lfz.corefacility.ca/sistr-app/" style="text-decoration: none;"><span style="background-color: transparent; color: #1155cc; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: underline; vertical-align: baseline; white-space: pre-wrap;">https://lfz.corefacility.ca/sistr-app/</span></a></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Genoserotyping, 1 day turn-around-time, high throughput (96 samples/day)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Non-subjective interpretation</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">O antigen (rfb cluster), somatic</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">H antigens (H1=fliC, H2=fliB), flagellar</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">SISTR can predict >2000 serovars</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Incorporates Achtman Salmonella MLST</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Classical MLST =7-9 genes, cgMLST=100’s to 1000’s core genes</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">SISTR cgMLST=330 genes → high assignability, low levels of “missing data”, will include international scheme when finished</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">SISTR interface → batch upload, on the fly typing, genome browser, visualization (can change min span tree according to selected metadata)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Under epi tab can select geographical visualization (by lat_lon or GPS co-ords) → click on node and table of metadata appears</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Also temporal distribution of strains</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Visualization only as strong as metadata provided</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Does not seem to be a command line version available </span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">FB: Ed Toboata said in person to me after this talk he’s interested in making a command line version available. There are some good docs at https://sistr-backend.readthedocs.org/en/latest/</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">cgMLST cluster is 86% correlation with its serovar (from metadata)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Phylogenetics can be used to make it 95% correlated</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">The last 5% due to bad or missing metadata</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"></span></div>
<hr />
<b style="font-weight: normal;"><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Philip Ashton; Public Health England</span></b><br />
<br />
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: italic; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Revolutionising Public Health Reference Microbiology Using Whole Genome Sequencing: A Case Study with Salmonella</span></div>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">WGA allows for digging deep into outbreaks and research trends</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">2500 serotypes -->99% clinical Enterica (50% Typhimurium & Enteritidis, other 50% other serotypes)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">peak of cases in 90’s (30 000 cases /year), currently 7-8000 cases/year</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">rate of decrease of incidence slowing</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Capacity of >3000 genomes per week with 2 miseq, 2 hiseq</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">pipeline: Kmer (18mer) → ID-->99.7% accurate subspeciation → can be used to detect contamination</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">MLST to predict serotype (for backwards compatibility) - 6887 isolates with WGS and phenotypic data -->96% match between genotype and phenotype (discrepancies due to 2 serotypes assigned to sincle serotype or eburst group, lab error, no ST/serotype lookup)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Method: short read seq typing → ST (& eburst grouping) → serotype</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">SISTR (PHAC)/SeqSero (CDC), SNP typing with most common serotypes, SnapperDB, FastQ → db eburst groups</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">eg 2014 14b outbreak (international), good traceback http://www.eurosurveillance.org/ViewArticle.aspx?ArticleId=21098</span></div>
</li>
</ul>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">MinION will be used more in the future</span></div>
</li>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<a href="http://www.genomebiology.com/2015/16/1/114" style="text-decoration: none;"><span style="background-color: transparent; color: #1155cc; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: underline; vertical-align: baseline; white-space: pre-wrap;">http://www.genomebiology.com/2015/16/1/114</span></a><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"> </span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<a href="http://www.nature.com/nbt/journal/v33/n3/abs/nbt.3103.html" style="text-decoration: none;"><span style="background-color: transparent; color: #1155cc; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: underline; vertical-align: baseline; white-space: pre-wrap;">http://www.nature.com/nbt/journal/v33/n3/abs/nbt.3103.html</span></a></div>
</li>
</ul>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">great trees, including the “Death star of Salmonella” - used Bionumerics Yep - my colleague Satheesh used Bionumerics to make that, partly because last time i used phyloviz, the bubble size didn’t scale with number of isolates.</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Slides here - </span><a href="http://www.slideshare.net/PhilipAshton1/whole-genome-microbiology-for-salmonella-public-health-microbiology" style="text-decoration: none;"><span style="background-color: transparent; color: #1155cc; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: underline; vertical-align: baseline; white-space: pre-wrap;">http://www.slideshare.net/PhilipAshton1/whole-genome-microbiology-for-salmonella-public-health-microbiology</span></a></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"></span></div>
<hr />
<b style="font-weight: normal;"><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Greg Armstrong; CDC (incoming head of AMD division)</span></b><br />
<br />
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: italic; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">The Application of Genomics to Public Health—an Epidemiologist’s Point of View</span></div>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">AMD Focus</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Polio - used seq longer than any other PH area</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Late 2013 → seq every isolate available → world eradication program in full effect</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Polio thought to be endemic in Afghanistan → seq showed isolates from Pakistan with sustained transition</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Seq in early 2014 showed isolates are all same in South Asia → intensified surveillance and immunization in southern Afghanistan</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Ebola - little asymptomatic infection so transmission chains are more obvious</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Guinea → consensus seq uploaded to Nextflu.org → married to metadata (on MicroReact) → useful for epi’s</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Listeria outbreak analysis: Normally the trees match PFGE but show a case where the PFGE didn’t match. Described how key to genomic epi is both having the genomic data AND the good epi (which in this case revealed that the outbreak was associated with carmel apples)</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Showed amusing Mycobacterium tuberculosis “tree” with no branches resulting from conventional genotyping with MIRU-VNTR (i.e. identical isolates): ….then showed tree illustrating how isolates could be differentiated by WGS</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">HIV transmission</span></div>
</li>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">contact tracing based on epi data</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">attribution table -25% social contact, integrating WGS and epi = >80% injection drug users</span></div>
</li>
</ul>
</ul>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">inferred HepC-V transmission</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Pertussis incidence increasing for 30yrs (acellular vaccine since ‘90’s)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Refer to posters for pertussis outbreak analysis. Huge increase in pertussis lately, primarily in California (California outbreak 2010)</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Influenza pipeline w/ NGS → faster, cheaper, more samples, more data, better data</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">impacts vaccine dev (informs what strains to build vaccine against based on typing from previous season)</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Pneumococcal pipeline w/ NGS → more PH data, more easily exportable, less prone to human error</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Mentions the need for bioinformaticians/bioinformaticists at CDC. FB: Good to encourage students to try work terms, scholarships/fellowships, at such public health agencies if they are interested in such positions. Many full time positions acquired after working in a public health agencies temporarily as part of a work term/trainee position.</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Lessons:</span></div>
<ol style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: decimal; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">data integration is an issue, usually diff data streams, need to integrate with external partners</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: decimal; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">culture-independent diagnostic tests impacting ability to get isolates</span></div>
</li>
</ol>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Which is best pipeline like asking “how big is a piece of string?”</span></div>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"></span></div>
<hr />
<b style="font-weight: normal;"><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Stefan Niemann; Research Center Borstel, Borstel, Germany</span></b><br />
<br />
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: italic; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Tracing Evolution and Spread of Mycobacterium tuberculosis Strains in Times of Antibiotic Treatment </span></div>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">90% of MDR-TB patients are not treated successfully</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Former Soviet Union is a hot-bed of MDR-TB</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Initially felt MDR-TB not easily transmitted due to decreased fitness associated with </span><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: italic; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">rpoB</span><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"> mutations</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Referring to </span><a href="http://www.nature.com/ng/journal/v45/n10/full/ng.2744.html" style="text-decoration: none;"><span style="background-color: transparent; color: #1155cc; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: underline; vertical-align: baseline; white-space: pre-wrap;">http://www.nature.com/ng/journal/v45/n10/full/ng.2744.html</span></a></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Conflicting information associated Beijing sub-lineage with MDR - did 24-locus MIRU with 4987 isolates, from 99 countries, WGS on subset of 110 isolates → the associated publication: </span><a href="http://www.nature.com/ng/journal/v47/n3/full/ng.3195.html" style="text-decoration: none;"><span style="background-color: transparent; color: #1155cc; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: underline; vertical-align: baseline; white-space: pre-wrap;">http://www.nature.com/ng/journal/v47/n3/full/ng.3195.html</span></a></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">First streptomycin mutations ~1970, when first treatment given - resistance mutations appeared way before DOTs initiated</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">MDr outbreak clone sin Eastern Europe due to antibiotic Tx and bottleneck selection</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Implementation of DOTs and DOTsPlus actually increase presence of the clones in Central Asia</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Compensatory mutations increasing fitness, i.e. transmissibility of drug-R clones</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">One of Stefan’s older papers on this: </span><a href="http://jcm.asm.org/content/48/10/3544.full" style="text-decoration: none;"><span style="background-color: transparent; color: #1155cc; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: underline; vertical-align: baseline; white-space: pre-wrap;">http://jcm.asm.org/content/48/10/3544.full</span></a></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Resistance prediction: </span><a href="http://www.ncbi.nlm.nih.gov/pubmed/26116186" style="text-decoration: none;"><span style="background-color: transparent; color: #1155cc; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: underline; vertical-align: baseline; white-space: pre-wrap;">http://www.ncbi.nlm.nih.gov/pubmed/26116186</span></a></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">74% of resistance strains had a single mutation, i.e. likely causal</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Whole genome MLST: </span><a href="http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4097744/" style="text-decoration: none;"><span style="background-color: transparent; color: #1155cc; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: underline; vertical-align: baseline; white-space: pre-wrap;">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4097744/</span></a><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"> </span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"></span></div>
<hr />
<b style="font-weight: normal;"><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"> Ruth Timme (Hugh Rand); FDA</span></b><br />
<br />
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: italic; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Benchmark Datasets for Validating Foodborne Outbreak Investigations: Integrating WGS and Phylogenomic Analyses</span></div>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">FDA/CDC/NCBI/FSIS(?) got together to develop a uniform approach for analysis comparison and standardisation of results.</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Lots of components in the benchmark - isolate, dna, raw data, meta data, output of analyses. how to compare these analyses?</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">I think this is really valuable, would be great to see the details as to the broader reasons of how and why to use these in the github (PA) - https://github.com/WGS-standards-and-analysis</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">The fact that outbreak/epi related isolates are so close makes the evolutionary genetics of it much simpler. it is harder to do broader evo studies.</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">If interested: </span><a href="https://github.com/CFSAN-Biostatistics/snp-pipeline" style="text-decoration: none;"><span style="background-color: transparent; color: #1155cc; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: underline; vertical-align: baseline; white-space: pre-wrap;">https://github.com/CFSAN-Biostatistics/snp-pipeline</span></a></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"></span></div>
<hr />
<b style="font-weight: normal;"><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Madeline Galac; Univ. of North Carolina at Charlotte</span></b><br />
<br />
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: italic; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Integrating Core Genome Phylogenetic Relationships and Isolate Geographic Data to Trace the 2012 Neisseria meningitidis Outbreak in New York City,</span></div>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Neisseria meningitidis, outbreak associated with MSM. 102 isolates, 79 serogroup C, 2003-2013. 19 outbreak isolates.</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Were all the outbreak isolates related? </span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Assembled illumina with velvet then used xBase to annotate (not Prokka or RAST, maybe an old study)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Found core genome w/orthomcl for single copy ortholog groups and aligned each gene MAFFT and concatenated ~500 genes. then raxml.</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Outbreak group was monophyletic, also had isolates from 2008. 2012 outbreak formed a single clone within that clade.</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Did a betweeness centrality analysis - i.e. the more a location is connecting other locations to each other</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Map the home location onto the tree, use paup to infer the ancestral states/changes. count the changes, make into network visualisation. Brooklyn had highest betweeness. vast majority coming out of brooklyn. this was over 10 year period.</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Did same thing for just the 2012 outbreak. there were specific neighbourhoods that played a more important role in this one. Aided study of transmission events. </span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">I would be interested to see whether there was an international aspect to this MSM outbreak as for Shigella http://www.ncbi.nlm.nih.gov/pubmed/25936611 (PA)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Also, multiple SNPs between cases could also be missed steps in transmission chain? FB: Great point. Note that Neisseria are naturally competent for DNA uptake (at 10-3 rate which is really high for bacteria - just spread DNA on a plate containing the 13 bp Neisseria uptake seq in it, spread the bacteria on top, and presto you get colonies the next day transformed with the DNA you wanted to add to them!). So these multiple SNPs between cases should really be studied further to see how they evolved…</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<a href="http://www.sciencemag.org/content/341/6144/328" style="text-decoration: none;"><span style="background-color: transparent; color: #1155cc; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: underline; vertical-align: baseline; white-space: pre-wrap;">http://www.sciencemag.org/content/341/6144/328</span></a></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"></span></div>
<hr />
<b style="font-weight: normal;"><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Maria Hoffmann; FDA</span></b><br />
<br />
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: italic; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Whole Genome Sequencing Provides Rapid Traceback of Clinical to Food Sources During a Foodborne Outbreak of Salmonellosis </span></div>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Salmonella Bareilly associated with wide host range, first isolated in India, 1928.</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Retrospective study, 100 isolates, 41 outbreak, 57 from background, going back to 1960s. finished a genome from the outbreak with pacbio.</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Bareilly is paraphyletic, one of the phyla associated with only east coast, one with west coast.</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Found an arsenic resistance island in salmonella heidelberg as a side effect of investigaing outbreak.</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Paper here </span><a href="http://jid.oxfordjournals.org/content/early/2015/06/25/infdis.jiv297.full.pdf" style="text-decoration: none;"><span style="background-color: transparent; color: #1155cc; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: underline; vertical-align: baseline; white-space: pre-wrap;">http://jid.oxfordjournals.org/content/early/2015/06/25/infdis.jiv297.full.pdf</span></a></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"></span></div>
<hr />
<b style="font-weight: normal;"><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Eija Trees; CDC, Atlanta, GA</span></b><br />
<br />
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: italic; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Transforming Public Health Microbiology in the United States with Whole Genome Sequencing (WGS) - PulseNet and Beyond </span></div>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">WGS to decrease turn-around-time to 2-4 days from (as much as) months</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">125$ with Miseq to sequence E. Coli </span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">did she miss some info in that cost total -RL? didn’t mention dna extraction for one (or the cost of the bionumerics license)....good point -RL.</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">MLST < rMLST < cMLST < wgMLST but all require manual curation</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">TS: I feel that comparison table (provided by BioNumerics) is very misleading!</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"></span></div>
<hr />
<b style="font-weight: normal;"><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">David Lipman, NCBI, Bethesda, MD</span></b><br />
<br />
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: italic; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Pathogen Genomics at NCBI</span></div>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Ultimately want to deal with 1000, 2000 isolates a day. </span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Masks the repetitive/phage/mobile parts of the genome before SNP tree-ing (est 4% of genome) </span><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"><br class="kix-line-break" /></span><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">FB: the % of genome masks varies greatly between species though.</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">TS: Density filtering of SNPs - a proxy for recombination detection? ala ClonalFrameML, Gubbins, BratNextGen</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Use “maximum compatibility” trees - does not allow homoplastic sites - all sites must agree with tree.</span><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"><br class="kix-line-break" /></span><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">TS: I found this reference: </span><a href="http://www.ncbi.nlm.nih.gov/pubmed/25634097" style="text-decoration: none;"><span style="background-color: transparent; color: #1155cc; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: underline; vertical-align: baseline; white-space: pre-wrap;">http://www.ncbi.nlm.nih.gov/pubmed/25634097</span></a></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Database of AMR genes mentioned but don’t note the collection of sources used. </span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"></span></div>
<hr />
<b style="font-weight: normal;"><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Dag Hamsen, University of Munster, Munster, Germany</span></b><br />
<br />
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: italic; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Overview of Tools for Microbial NGS Data Analysis</span></div>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">SURPI was the pipeline used for diagnosis of neuroleptospirosis in NEJM 2014 (TS: which cited our Leptospira genome paper, yay!)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Tablet - next gen sequence assembly visualization</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Mapathon - used simulated bacterial data -> BWA + GATK diploid as best combination of tools for SNPs and indels (interesting, is this Unified Genotyper or HaplotypeCaller by GATK? UG has been decommissioned by Broad in favour of HC)</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"></span></div>
<hr />
<b style="font-weight: normal;"><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">David Aanensen, Imperial College, London, UK</span></b><br />
<br />
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: italic; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Community and Social Data / Applications for Pathogen Genomic Surveillance</span></div>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Demoing </span><a href="http://www.spatialepidemiology.net/" style="text-decoration: none;"><span style="background-color: transparent; color: #1155cc; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: underline; vertical-align: baseline; white-space: pre-wrap;">http://www.spatialepidemiology.net/</span></a><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"> the super awesome </span><a href="http://microreact.org/" style="text-decoration: none;"><span style="background-color: transparent; color: #1155cc; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: underline; vertical-align: baseline; white-space: pre-wrap;">http://microreact.org/</span></a><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"> and also seems awesome </span><a href="http://www.wgsa.net/" style="text-decoration: none;"><span style="background-color: transparent; color: #1155cc; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: underline; vertical-align: baseline; white-space: pre-wrap;">http://www.wgsa.net/</span></a><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"> (the latter slated for full release in December)</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Johnathan Jacobs raised the excellent point via twitter: Is microreact etc open source? Tweet back noted </span><a href="https://github.com/ImperialCollegeLondon" style="text-decoration: none;"><span style="background-color: transparent; color: #1155cc; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: underline; vertical-align: baseline; white-space: pre-wrap;">https://github.com/ImperialCollegeLondon</span></a><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"> and indicated those not there are on the way... </span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"></span></div>
<hr />
<br />
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 18.666666666666664px; font-style: italic; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Shorter (15 minute) talks</span><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"></span></div>
<hr />
<br />
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Xiangyu Deng, University of Georgia, Griffen, GA</span></div>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: italic; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Salmonella Serotype Determination Utilizing High-Throughput Genome Sequencing Data</span></div>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">30K isolates serotyped/year by US PH depts</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Retrofitting WGS to phenotyping</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Serotyping - including backwards compatibility</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">46 O-antigens, 114 H-antigens => 2500+ serotypes</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">SeqSero pipeline </span><a href="http://www.denglab.info/SeqSero" style="text-decoration: none;"><span style="background-color: transparent; color: #1155cc; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: underline; vertical-align: baseline; white-space: pre-wrap;">http://www.denglab.info/SeqSero</span></a></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<a href="http://www.ncbi.nlm.nih.gov/pubmed/25762776" style="text-decoration: none;"><span style="background-color: transparent; color: #1155cc; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: underline; vertical-align: baseline; white-space: pre-wrap;">http://www.ncbi.nlm.nih.gov/pubmed/25762776</span></a></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Identify correct allele by multiple rounds of mapping and BLAST</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">TS: would de novo assembly and BLAST be simpler? the two flagellar (h antigen, fliC and fljB) loci are sometimes 60% similar to each other (DNA or AA ?) (dna), might screw with assembly blast. I think in the right hands the assembly blast. would work.</span></div>
</li>
</ul>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">one phenotype can be underlyed by multiple genotypes in the H antigen determining genes </span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">98.7% accuracy for reads (what is it for assembly?), takes a few minutes (!) on 4 cores. (that’s pretty good)</span></div>
</li>
<li dir="ltr" style="background-color: white; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: white; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Did he say 99% accurate for ass+blast? in follow up with him afterwards, he seemed to back track on this (PA)</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">FB: I hate to say it but it depends how you define “accuracy” - sometimes actually mean precision or recall. Can ask, since having great recall/sensitivity is great, but not at expense of crappy precision/specificity. </span></div>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">TS: Is there a command line version of this? </span></div>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">PA: Author claims “Yes” according to Kat, he said it is available on request - he emailed it to me btw.</span></div>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"></span></div>
<hr />
<b style="font-weight: normal;"><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Errol Strain - CFSAN, FDA</span></b><br />
<br />
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: italic; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">CFSAN SNP pipeline: a whole genome sequencing data analysis pipeline for food-borne pathogens</span></div>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">good practical advice for software validation </span><a href="http://www.fda.gov/RegulatoryInformation/Guidances/ucm085281.htm" style="text-decoration: none;"><span style="background-color: transparent; color: #1155cc; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: underline; vertical-align: baseline; white-space: pre-wrap;">http://www.fda.gov/RegulatoryInformation/Guidances/ucm085281.htm</span></a></div>
</li>
</ul>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Generate reads with known variants - for testing pipelines: </span><a href="https://github.com/lskatz/lyve-SET" style="text-decoration: none;"><span style="background-color: transparent; color: #1155cc; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: underline; vertical-align: baseline; white-space: pre-wrap;">https://github.com/lskatz/lyve-SET</span></a></div>
</li>
</ul>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Only use reference < 5000 SNPs away (0.1% divergent)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Some post-facto filtering of phage, manually filtered</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Salmonella Newport quite diverse, 15 SNPs might be linked </span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">How to share this kind of information, just in publications, or in some other way?</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">That scares me (TS) that snp thresholds are so different for different serovars. Need domain experts,</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"></span></div>
<hr />
<b style="font-weight: normal;"><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Ivan Liachko, University of Washington, Seattle, WA</span></b><br />
<br />
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: italic; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Assembling whole genomes from mixed microbial communities using Hi-C</span></div>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">taking advantage of the innovation of reconstructing chromosome conformation in human genetics</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">paper on this http://www.g3journal.org/content/early/2014/05/22/g3.114.011825.abstract</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Hi-C=chromosome conformation capture</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">cross linking occurs in cell before cell disruption. this allows you to bin contigs from the same original organism. also, within organism you get long range scaffolding information. problem can be chimeras </span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">For the paper: </span><a href="http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4455782/" style="text-decoration: none;"><span style="background-color: transparent; color: #1155cc; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: underline; vertical-align: baseline; white-space: pre-wrap;">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4455782/</span></a></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">note: some bacteria have multiple copy number chromosomes eg. Neisseria ~ 5</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">See also Dovetail technology: </span><a href="http://dovetailgenomics.com/" style="text-decoration: none;"><span style="background-color: transparent; color: #1155cc; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: underline; vertical-align: baseline; white-space: pre-wrap;">http://dovetailgenomics.com/</span></a></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"></span></div>
<hr />
<b style="font-weight: normal;"><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Fangfang Xia, University of Chicago</span></b><br />
<br />
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: italic; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">PATRIC pipeline</span></div>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Speaker was unable to attend and present.</span></div>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"></span></div>
<hr />
<b style="font-weight: normal;"><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Rima Khabbaz, CDC, Atlanta GA</span></b><br />
<br />
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: italic; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Integrating Molecular Technologies in Public Health</span></div>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Office of Advanced Molecular Detection pioneering integrating WGS into PH</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Goals: IT and lab infrastructure expansion, PH workforce (training and career paths for bioinformaticians), develop programs and projects for AMD innovation</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">AMD in Action</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Foodborne diseases (centrepiece)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">-culture independent diagnostics</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">PulseNet (won innovation award), changed how we identify food outbreaks → centralized national DB, creation of PulseNet has resulted in largest recalls ever for PH improvement</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">eg Listeria surveillance with WGS</span></div>
</li>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">#’s more manageable, well characterized human and food/enviro samples</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">greatly successful, created infrastructure to do WGS in PulseNet (1700 patient, ~2500 food/enviro samples seq)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">currently comparing clusters generated by PFGE and WGS</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">WGS results in more clusters, with fewer cases/cluster</span></div>
</li>
</ul>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">moving to Campy and E. coli surveillance and eventually Salmonella</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">eg Influenza</span></div>
</li>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">CDC Influenza Division important player in surveillance (1 of 5 centres)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">monitor virus variation throughout year to inform viral strain selection for vaccine production in Sept (eg 2014 Southern Hemisphere Vaccine)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">also monitor antiviral resistance</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">WGS has changed viral profiling pipeline → genetically profile FIRST then select subset to propagate/isolate followed by phenotypic characterization → faster, cheaper </span></div>
</li>
</ul>
</ul>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">eg HIV</span></div>
</li>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">million people in US living with disease (50% living in 4 states including Cali and Florida)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">WGS improves transmission dynamics studies, allows faster PH response (needle exchange, better drug treatment)</span></div>
</li>
</ul>
</ul>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">eg MERS (Middle Eastern Respiratory Syndrome)</span></div>
</li>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">automated microfluidics in barcoding pipeline</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">several genomes already submitted to Genbank</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">human seqs track with camels</span></div>
</li>
</ul>
</ul>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">eg Bourbon virus (emerging in Kansas), tick-borne</span></div>
</li>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">WGS for pathogen discovery </span></div>
</li>
</ul>
</ul>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">eg AMR</span></div>
</li>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">WGS adds level of precision, improving knowledge of transmission (endemic in Long term care facilities/nursing homes), highlighted need for regional approach → Centres of Excellence planned</span></div>
</li>
</ul>
</ul>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Challenges:</span></div>
</li>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Innovation</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Lack of standardization</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Automation of analyses for high volumes of data</span></div>
</li>
</ul>
</ul>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"></span></div>
<hr />
<b style="font-weight: normal;"><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Charles Chiu, Univ of California</span></b><br />
<br />
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: italic; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">SURPI: Deep Sequencing of Infectious Disease</span></div>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Omni-omics for infectious disease diagnosis</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Focus on metagenomics for clinical infectious disease diagnosis</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Agnostic approach-->nearly all microbes can be uniquely identified by NGS</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Factors for choosing a platform: cost, speed, volume of data, turn-over-time</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Target clinical unmet need: pneumonia (15-25% unknown cause), meningitis/encephalitis (40-60% unknown cause), fever/sepsis (20% unknown cause)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Key:SPEED (mins to hours), epi studies take too long “time is of the essence”</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Require sensitivity and accuracy, HIPAA-compliant! (EMR integration), reference databases, user-friendly (for PH workers with no bioinformatics expertise)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Chiu and Miller 2015 for metagenomic pipeline, wet lab part fairly standard but bioinformatics analysis NOT (req “host subtraction” and essentially throw that info away, align remaining reads to pathogen databases)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Computational bottleneck (days to weeks to run this analysis)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Kraken (fast taxonomic classifier), first “unbiased, comprehensive benchmark”</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Many other tools NOT benchmarked</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">SNAP/Bowtie2/STAR (fast nucletotide aligners), 100’s-1000’sx faster (now clinically meaningful timeframes) than BLAST </span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">DIAMOND (fast translated nucleotide/protein aligner)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">EDGE Bioinformatics (see Patrick Chaing, Los Alamos), Chris Detter</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">ONE Codex, best-in-class accuracy, minutes for turn-around-time, HIPAA</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">PathoScope, modular </span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">GENIUS (COSMOSID)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Pathosphere, suite of tools</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">SUPRI: Seq based ultra rapid pathogen ID, for bioinformatics nubes, uses entirety of NCBI NT ref DB, clinical version of SUPRI under dev</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Cloud version (Google cloud) and laptop version able to run on resource poor settings</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">NT alignment with SNAP, fast and scalable</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Research vs clinical versions→ clinical mods include automated filtering, metadata tagging (background vs contamination vs pathogen), taxonomic classification, pipeline optimization, visualization, server and cloud implementation</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">eg neuroleptospirosis (Josh Osborne) diagnostics, 2yrs ago misclassified because actual pathogen not in the database</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">eg male with deafness and behavioural change, plethora of diagnostic tests in hospital, under 5hrs WGS identifies astro virus encephalitis</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">eg hemorrhagic encephalitis, extensive diagnostics were negative, NGS Dx IDs amoebic infection (Balamuthia, in under a week), couldn’t have made diagnosis earlier b/c Balamuthia poorly represented in ref DB but could have if DB more comprehensive</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">eg eosinophilic meningitis, tests for viruses, fungi and parasites negative, 2014 DB gives Malassesia (dandruff) top hit, 2015 NGS Dx Angiostrongylus (correct Dx, positive PCR from CDC), Dx had clinical impact!!</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">going forward, want everything to be in CLIA framework</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">SUPRI→ CLIA-certified pipelines with 24hr TAT, HIPAA compliant, data integration to get NGS Dx’s into patient EMRs</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">precision medicine consult team will access data for decision making </span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">has capacity for genotyping but not automated in clinical version </span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">CNS “sterile”, easier to validate sterile sites</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Docker container available to disseminate SUPRI</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"></span></div>
<hr />
<b style="font-weight: normal;"><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Randall Olsen, Houston Methodist, Tx</span></b><br />
<br />
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: italic; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Genomics and Transcriptomics in Clinical Microbiology</span></div>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">PCR based tests, MALDI-TOF, WGS to inform and improve patient care</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">20yrs ago H. influenzae genome seq >1 million, >1yr</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">“the $10 microorganism genome will soon be a reality”</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">“day in the life of a microbio lab” → 130 samples from 116 patients, can WGS ID unknown organisms for these?</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">88.5% concordance with ref method, ID’d Mycobacterium 10 days before conventional culture based diagnosis</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">10 organisms unable to ID by WGS because of deficiency in ref DB</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Lack of fungi in ref DBs!</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">400 genomes in validation study (bacteria, fungi and viruses) → 600 clinically ordered WGS tests now! used to supplement routine tests (particularly for fungi and Mycobacterium, also Salmonella and Influenza A to get rapid serotype)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Invoke WGS to improve patient care eg AMR, unusual disease presentation (B. cereus → anthrax-like, acquired anthrax toxins on plasmid, informed institutional response)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">“Fire drill” for outbreak detection rehearsal, “mock rapid response scenario”, is mock outbreak clonal? what actionable info in clinically relevant timeframe can be generated by WGS → seq analysis in 3 days, select subset and conduct follow up studies</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">WGS showed 5 clusters,informed transmission not initially appreciated in epi studies</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Also examined gene expression profiles (RNA-Seq), transcriptomics show diffs in strains, has ABC capsule virulence factors overexpressed (unexpected based on genomics), non-coding regions in WGS pipeline previously not analyzed, overexpression of yesMN genes (virulence) led to discovery that there was mixed population (resulting in mods to genomics pipeline)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Combining Omics and animal models together enables testing of hypotheses and therapies, integrated as “disaster preparedness plan” </span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"></span></div>
<hr />
<b style="font-weight: normal;"><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">George Garrity, Michigan State Univ, Lansing Mi</span></b><br />
<br />
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: italic; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">A New Genomics-Driven Taxonomy: Are We There Yet?</span></div>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">International Code of Nomenclature of Prokayotes (2008 ed) → anchor points, provide ref organisms</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">2 culture collections in 2 parts of world → provides refs for changes in platforms, methods etc</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">regulates nomenclature but not taxonomic methodology!!</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">field is dynamic, in 1980 2 200 names, currently 15-16 000 (moving target)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">35 000 “nomenclatural acts” since 1980</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">1980 purged 1000’s of names! only 5% names survive from 80yrs ago</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">taxon calling (“OTUs”) vs identification → need for standards (rigorously validated)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">proposal for open experiment setting forth series of test cases to test methodologies (are questions asked correct?)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Analysis and Validation Methods → “Name for Life” Commercial services</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">objective: create infrastructure to support validation system for ID Bacteia/Archaea to incorp genomics data</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Peter Sneath, “father of numerical taxonomy” (does calculations by hand, doesn’t trust computers), max likelihood 16S tree no longer calculable → Garrity to arrange info in Bergey’s Manual</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Currently, thresholds for classification overlap</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Principal components analysis of data (nucleotide identity, aa identity, kmer)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Latent semantic analysis against 16S data, ANI, AAI</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Size of genome is problem</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">PCA analyses - ancillary plot should contain 85% of data</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Need to develop distortion free data viz tool</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Pairwise combination anywhere in the heat map</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Nearest neighbours → move out and find boundaries of taxa</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Classifier goes through matrices of heat maps, >2SD → flag for reclassification (sp level rearrangement)</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">eg Streptomyces → novel microbial products, nomenclature got “cleaner”</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">eg Eubacterium should be phylum</span></div>
</li>
</ul>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">eg Mycoplasma could be more genera</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">take home: statistical use of genomics data to develop better taxonomy</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"></span></div>
<hr />
<b style="font-weight: normal;"><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"> </span></b><br />
<br />
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Martin Maiden; Univ. of Oxford, Oxford, United Kingdom</span><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: italic; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"> </span></div>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: italic; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Beyond Typing and Phylogeny: the Population and Functional Genomics of the Neisseria</span></div>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">19yrs ago everyone developing own gel-based methods → gradual adoption of PCR and nt-based detection</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">MLST based on housekeeping genes</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">7 loci used for 100 Neisseria, 7 loci ST summarizes 3 284 bp = 0.15% of 2.18 Mb genome (compresses 3200 bp in 7 digits =ST)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">11 525 STs, 35K isolates, 507-780 alleles/loci → can use “bursts” to cluster STs (stable complex)</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Reviewing BIGSdb http://pubmlst.org/software/database/bigsdb/ </span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">PubMLST</span></div>
</li>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">1300 submitters, data curated → 90 MLST scheme used for molecular typing, species ID</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Autotagger to annotate genomes (can feed into NeighbourNet)</span></div>
</li>
</ul>
</ul>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Maiden 2013, Nat Rev Microbiol (Hierarchical genome analysis)</span></div>
</li>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">16S-->MLST-->rMLST-->wgMLST</span></div>
</li>
</ul>
</ul>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Mentioning Alexander von Humboldt’s Three Stages of Scientific Discovery:</span></div>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">first they deny its true</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">then they deny its important</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">then they credit the wrong person</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Neisseria spp. - studying diverse phenotypes</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Mening carriage across the meningitis belt - study published this year: </span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">“The Diversity of Meningococcal Carriage Across the African Meningitis Belt and the Impact of Vaccination With a Group A Meningococcal Conjugate Vaccine.”</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">http://jid.oxfordjournals.org/content/212/8/1298.long</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">More data re vaccinated vs unvaccinated districts - showed herd immunity occurring in the vaccinated region vs non-vaccinated regions. FB: There is a pub associated with herd immunity that Martin mentioned to me at lunch: </span><a href="http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3988355/" style="text-decoration: none;"><span style="background-color: transparent; color: #1155cc; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: underline; vertical-align: baseline; white-space: pre-wrap;">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3988355/</span></a><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"> </span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Also mentioned paper “Implications of Differential Age Distribution of Disease-Associated Meningococcal Lineages for Vaccine Development” </span><a href="http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4054250/" style="text-decoration: none;"><span style="background-color: transparent; color: #1155cc; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: underline; vertical-align: baseline; white-space: pre-wrap;">http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4054250/</span></a><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"> </span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Napoleon: “History is the version of events that people decided to agree upon.”</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b><br />
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"></span></div>
<hr />
<b style="font-weight: normal;"><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Abu Mustafa; Kuwait Univ., Jabriya, KUWAIT </span></b><br />
<br />
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: italic; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Next Generation Sequencing of </span><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Brucella melitensis</span><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: italic; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"> Isolates from Kuwait and Comparative Genome Analyses </span></div>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Brucellosis - reservoirs include camels, dogs, goats, swine, sheep</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">found in milk, cheese, dairy</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">highly infectious, aerosol transmission</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">potential biological agent, painful illness</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">top 10 impactful diseases to poverty ridden humans</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">difficult to diagnose relapse vs re-infection</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">culture, biochemical characterization, serotyping used traditionally for ID of spp/biovars</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">new methods needed for surveillance (in Kuwait, all B. melitensis)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">identified 15 B. melitensis by PCR and standard methods (16S)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">reads trimmed and filtered with FastX tool</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">QUAST used for assembly quality</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">2 chromosomes, 1.2 & 2.1 Mb</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">All unpublished:</span></div>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">going through all methods, parameters in detail at start. </span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Genomes seq’d immediately reveals one the </span><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: italic; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">B. melitensis</span><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"> isolates was an outlier but no other information was provided</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">10 variants/kb and 14 variants/kb in chrom 1 and 2, respectively</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Two major variant groups, plus the one outlier seen clearly in trees. </span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Mentions isolate-specific variations identified, aiding epi studies as possible markers </span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b><br />
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"></span></div>
<hr />
<b style="font-weight: normal;"><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Scott Federhen; NCBI, Bethesda, MD </span></b><br />
<br />
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: italic; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Microbial Genomic Taxonomy at GenBank </span></div>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">“Taxonomy in the trenches”</span></div>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Type vs genome from type</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">ProxyType scores vs ANI to type (ANI cutoffs change between spp)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Curation to correct misidentification </span><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">(NCBI will just change name and add comment block instead of asking permission of author)</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Planning to change names in entries that seem to be incorrectly taxonomically predicted - with a comment showing the “ANI” percentage for old name versus (higher ANI) new name as evidence. Going to notify authors of this change, but this is the first time they won’t require author acceptance to change a Genbank entry. FB: This is really notable since the first time genbank is making blanket changes to original genbank entries (rather than their curated RefSeq) in this way without author agreement. However, they had a workshop with taxonomists to consult with them on this, and got agreement on making a blanket change. Federhen says they are trying to be really careful with this one. I’m sure the authors would appreciate the notice, and these fixes are necessary, but author input may also be key to note any errors in the automated approach, and make potential improvements to taxa correction that may be even more accurate.</span></div>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"></span></div>
<hr />
<br />
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Kat Holt, Univ of Melbourne, Australia</span></div>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: italic; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">What do we need from microbial genomics surveillance software?</span></div>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">What are the considerations for using a genomics pipeline in a PH setting?</span></div>
<ol style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: decimal; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">what are we looking at (bits of genome, SNPs, MLST, Kmer, core genomes, outputs, confidence values)?</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: decimal; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">how do we know it’s right?</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: decimal; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">who is doing the analysis? what do i need? what are the inputs? will it all fit in with what I do right now?</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: decimal; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">reproducibility? robust outcomes? how will the system/pipeline change with future updates, contamination or need for troubleshooting?</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: decimal; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">are results interpretable? how is metadata integrated?</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: decimal; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">will the results allow us to make good PH decisions and how will we know?</span></div>
</li>
</ol>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"></span></div>
<hr />
<br />
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Errol Strain- CFSAN, FDA</span></div>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Datasets for the challenge: </span></div>
</li>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Multistate Listeria outbreak (18 isolates)-need to do matching to NCBI enviro/food isolates -> “elementary”</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Enteritidis (50 isolates), matching to known clusters -> “more difficult”</span></div>
</li>
</ul>
</ul>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"></span></div>
<hr />
<b style="font-weight: normal;"><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Yan Luo - CFSAN, FDA</span></b><br />
<br />
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Bowtie2-->SAMtools-->variants-->customscript for SNPlist-->SNPmatrix</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Docs: </span><a href="http://snp-pipeline.readthedocs.org/en/latest/" style="text-decoration: none;"><span style="background-color: transparent; color: #1155cc; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: underline; vertical-align: baseline; white-space: pre-wrap;">http://snp-pipeline.readthedocs.org/en/latest/</span></a></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Listeria:1300SNPs b/w facility 1 and 2, 6 clinical matches to facility 1</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">METADATA IS IMPORTANT TO INTERPRET YOUR TREE! </span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Salmonella: more diverse than Listeria, more clusters</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"></span></div>
<hr />
<b style="font-weight: normal;"><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Hannes Pouseele - Applied Maths</span></b><br />
<br />
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">BioNumerics 7.5 - used wgMLST and wgSNP point and click GUI modules</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">ie. assembly based + assembly-free ; want both to agree for confidence (within caveats)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">rough and fine cluster detection, resolving clusters req’s exposure etc (more metadata)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">calculation engine→ “warm shoebox”</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Option to have the engine in the cloud rather than physical machine purchase</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">26min to run one Listeria sampl (Velvet assembly took 16min alone)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">included some QC highlights, possible contamination detected</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"></span></div>
<hr />
<b style="font-weight: normal;"><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Katja Einer-Jensen - Qiagen (CLC)</span></b><br />
<br />
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">pipeline details at poster 6</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">dashboard includes running analyses side-by-side with metadata</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"></span></div>
<hr />
<b style="font-weight: normal;"><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">David Aanensen - Imperial College / Sanger</span></b><br />
<br />
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">population tree: ref genomes-->FastQ-->draft genomes-->core gene families</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">new metadata can be added as req’d to csv file</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">population tree looks nice (visualization), pretty slick, can select “source” metadata to overlay on tree </span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<a href="http://wgsa.net/" style="text-decoration: none;"><span style="background-color: transparent; color: #1155cc; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: underline; vertical-align: baseline; white-space: pre-wrap;">http://wgsa.net/</span></a></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"></span></div>
<hr />
<b style="font-weight: normal;"><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Jörg Rothgänger - Ridom</span></b><br />
<br />
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">SeqSphere</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">cgMLST, cluster threshold <10</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">SRA FATSQ, epi download→ assembly, allele calling → QC and EWS → Tree</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">nice metadata visualization (isolation source, collection date, geo_loc) </span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">state info missing for clinical cases</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">ad hoc cgMLST for Enteritidis, more complex tree</span></div>
</li>
</ul>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">SNP typing cluster criteria from FDA</span></div>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">can get SeqSphere (and solve outbreaks) from the comfort of home!</span></div>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"></span></div>
<hr />
<br />
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Torsten Seemann - Uni Melbourne </span></div>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">URL: </span><a href="https://github.com/tseemann/nullarbor" style="text-decoration: none;"><span style="background-color: transparent; color: #1155cc; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: underline; vertical-align: baseline; white-space: pre-wrap;">https://github.com/tseemann/nullarbor</span></a></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Nullarbor pipeline (unix command line): Job name/ID→ csv file input → MLST → phylogeny</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">sequencing QC→ identified possible contamination/mixed population? (species ID with Kraken), assembly with Megahit to “good enough quality”</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">resistome report using Abricate software based on assembled contigs</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">core genome based on alignment to ref using Snippy</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">ML tree using FastTree</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">SNP distance matrix that epi’s get to see</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Fripan uses Roary to determine pan genome</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">one Listeria sample seems to have 2 genomes</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">ref for Salmonella should be within 1000 SNPs</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Message: use pan as well as core genome, combine multiple lines of evidence</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">TS: won prize for being first (only?) pipeline to detect </span><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: italic; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">L.innocua</span><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"> contaminant</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"></span></div>
<hr />
<br />
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Nabil-Fareed Alikhan - Uni Warwick</span></div>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Enterobase: analyses, curation, AMR, pan-genome, core SNPs, AMR → goal: make it useful to all people</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">simple web interface</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Enterobase updates from SRA hourly</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">detected some QC issues</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">cgMLST</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">2-3 clusters identified, need more metadata to resolve cluster 3</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">BioNumerics 7.5</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">1% diff=36 alleles</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<a href="http://enterobase.warwick.ac.uk/" style="text-decoration: none;"><span style="background-color: transparent; color: #1155cc; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: underline; vertical-align: baseline; white-space: pre-wrap;">http://enterobase.warwick.ac.uk</span></a></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"></span></div>
<hr />
<br />
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Philip Ashton - Public Health England</span></div>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">SnapperDB</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">GitHub and CLIMG image (cloud infrastructure for bioinformatics, Birmingham, Warwick, Swansea)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">install often hardest part of any pipeline</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">FASTQs→ SNPdb (PostgreSQL) --> SNP alignments→ tree</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">lists variants and ignored positions</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">generates SNP address kind of like IP address</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">connect isolates within 100 SNPs of each other</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">nice SNP address tree</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"></span></div>
<hr />
<br />
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Aaron Petkau - PHAC, Canada</span></div>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">SNVPhyl, part of Canada’s IRIDA gen epi platform</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">integrates genomics, epi, lab, clinical metadata</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">ref mapping → variant ID and filtering → wg phylogeny </span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">implemented in Galaxy (web interface, API, provenance), QA/QC reporting, re-labeling of tree</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Listeria: ref produced de novo with SPAdes, remove phage and repeats</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">matches defined as isolate within 0-4 SNVs </span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">~100 SNVs between facility 1 and 2</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">removed ASM20, too little data, didn’t meet min coverage of 10x after filtering</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">3 clusters matching with clinical test dataset</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">One of the few methods mentioning the use of Galaxy for workflow</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"></span></div>
<hr />
<br />
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Martin Thompson, Centre for Genomic Epidemiology, DTU</span></div>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">KmerFinder and assembly→ ResFinder → MLST based on results from KmerFinder → other “Finders”</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">batch upload</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">can download results in excel file</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Pipeline is available as a Docker image here: (i know it exists somewhere)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">CSIphylogeny (SNP tree), BWA mapping, quality >30, depth >10, distance to nearest SNP >10</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Ndtree (Kmer based)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">a lot of Salmonella linkage</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"></span></div>
<hr />
<br />
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Zamin Iqbal - Uni Oxford</span></div>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Cortex asoftware: </span><a href="http://cortexassembler.sourceforge.net/" style="text-decoration: none;"><span style="background-color: transparent; color: #1155cc; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: underline; vertical-align: baseline; white-space: pre-wrap;">http://cortexassembler.sourceforge.net/</span></a></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Reference free de Bruiijn Graph (DBG) - sits between de novo assemnly and read alignment</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">4000 samples too 2 days using ~16 cores</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">But can save these caluclations and re-use for future analysis ie. background samples</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">FastTree for tree</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">looking only for segregating variation, matter of minutes</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Map back coordinates to “close reference” (unclear)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Awesome phage sharing matrix heatmap with hierarchial clustering</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Using phage to distinguish close samples on tree</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">AMR identification module</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"></span></div>
<hr />
<br />
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Nick Greenfield - One Codex</span></div>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">assembly free</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">focused on improving ref DB (>40 000 distinct genomes, reduce false positives)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">no Listeria typing DB</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">FASTQ→ add metadata→ metagenomic classification</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">found 2 clusters</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"></span></div>
<hr />
<br />
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Bill Klimke - NCBI</span></div>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">quality issues and standards for NGS</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">need to draw attention to where all points errors could arise (wet lab/computational analyses) so they can be addressed</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">samples dependent on metadata and contextual data</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">sample mixups, contamination, digital data mixups</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">need better standardized ways of integrating data</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">QA/QC is moot if upstream errors not reduced/solved</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"></span></div>
<hr />
<br />
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Bruce Budowle, Univ of Texas, Austin, Tx</span></div>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: italic; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Microbial forensics and its needs for standards and standardization</span></div>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Excluding culprits is as important as identifying culprits</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Info can be limited but still useful. microbial forensics is multidisciplinary</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Bioterrorism investigations complicated by background noise of sporadic and accidental foodborne pathogens at large</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Food and agriculture targets eg US vs Canadian BSE in cows, who has madder cows?</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Wide number of forensic outcome scenarios, possibly retaliation such as invasion </span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Who, what, when, where to assess plausibility of bioterrorism acts</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Need to supply standards of proof with measures of certainty</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Quality assurance guidelines to advise community (valid,</span><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"> </span><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">rigorous)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Need to define validation (spans collection, shipping and storage, extraction, analysis, interpretation), criteria and outcomes that qualify (and exceptions or alternatives during extreme circumstances)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Need some stability to create gold standard, if technology always changing, not good as benchmark</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Practitioners can’t afford dynamic change</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Standards: references (DBs and panels), quality metrics and levels; Standard Performance Methods Requirements (SPMRs)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">“protect the country” </span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Clonality, unknown histories, abandon concept of individualization?</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Attribution decisions require more info than just genomics (+law, policy, intelligence etc)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Correcting bacterial genome metadata with AutoCurE!!</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Marker selection criteria (eg gene scoring)</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Goal is attribution - who committed the crime, as well as who did not commit the crime</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Science does not have to say something beyond reasonable doubt, that is the requirement of the whole case. microbial forensics, have to deal with plethora of potential culprits.</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">high background, need epidemiology to distinguish deliberate release. Peanut guy who got arrested - microbial evidence is part of the case, not the whole shebang. was that a joke about native americans and smallpox?</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">validation - define limitations of technique so don’t go beyond the boundaries of your method. in exigent circumstances, can accept non-’validated’ results.</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Gold standard just means more people using it than something else</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Don’t want to become a prisoner of QA.</span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">When thinking about adoption of new techniques, need to take a new look at old techniques to make a proper comparison of pros/cons </span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"></span></div>
<hr />
<br />
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Paul Keim, Northern Arizona Univ, Flagstaff, Az</span></div>
<b style="font-weight: normal;"><br /></b>
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: italic; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Anthrax - Molecular epidemiology and forensics from WGS and metagenomic sampling of complex specimens</span></div>
<b style="font-weight: normal;"><br /></b>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">The anthrax FBI investigation</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">B. anthracis strictly clonal, no evidence of LGT</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Canonical SNPs (landmarks for naming)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Mutations causing phenotypic diffs all within markers</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Outbreak of anthrax could take years to develop, and perhaps decades to detect</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">nASP (“pipelines are like elbows, everybody’s gotta have at least 2”), open source, ref-dependent (single or pan-genome), supports reads or assemblies, fast, scale linearly</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Monsoon</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">~12 000 SNPs, use for inclusion vs exclusion</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">“A clade”, out of Africa (10 000yrs ago) </span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">eg anthrax and heroin users in Scotland</span></div>
</li>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">200 suspected cases, 100 confirmed</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">14 deaths</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Scotland, England, Germany</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">using canonical SNPs, 2 Turkish isolates closest to Scottish drug user isolate</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">concluded that heroin contaminated during smuggling process → feds ran with idea, which turned out to be too strong</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">expanded European screening → PCR-based assay + bigger ref populations → 2 outbreaks!</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">but injectional anthrax groups overlapped in time and space</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">req’d bilateral agreements → model collaborative project to get Germany to work with US (contracts in place)</span></div>
</li>
</ul>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Soviet Union weaponized spores in industrial complex (Sverdlovsk)</span></div>
</li>
<ul style="margin-bottom: 0pt; margin-top: 0pt;">
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">1979 left most filters off production facility, rupturing remaining filters, sending out plume of spores</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">in violation of international treaties</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">US obtained fixed pathology samples from victims, PCR confirmed B. anthracis</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">how low can you go and still ID strains? normally 50-100x coverage, 20x, 10x, 1x (would result in 10 000 miscalled SNPs at 1x - only 12 000 known SNPs in species)?</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">WG - FAST (focus array SNP typing)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: circle; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">turns out 1x can be done! oly genotype SNPs you already know!</span></div>
</li>
</ul>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Placement confidence landscape (with E. coli, 270 genomes x 255 000 SNPS, phylogenetic position matters, only 500 SNPs req’d to place!)</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">can examine AMR to see if Russians using AMR strains → absolutely WT</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">Based on Monte Carlo resampling, need 500 SNPs to ID/place in tree with 95% accuracy</span></div>
</li>
<li dir="ltr" style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; list-style-type: disc; text-decoration: none; vertical-align: baseline;"><div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">No culture? no problem with GOOD REF!!</span><span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 400; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"><span class="Apple-tab-span" style="white-space: pre;"> </span></span></div>
</li>
</ul>
<b style="font-weight: normal;"><br /></b><br />
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"></span></div>
<hr />
<br />
<br />
<div dir="ltr" style="line-height: 1.38; margin-bottom: 0pt; margin-top: 0pt;">
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;">END</span></div>
<div>
<span style="background-color: transparent; color: black; font-family: Arial; font-size: 14.666666666666666px; font-style: normal; font-variant: normal; font-weight: 700; text-decoration: none; vertical-align: baseline; white-space: pre-wrap;"><br /></span></div>
Torsten Seemannhttp://www.blogger.com/profile/12241185247897084810noreply@blogger.com12tag:blogger.com,1999:blog-1071661434473559589.post-78024588692652087302015-04-25T12:37:00.000+10:002015-04-25T13:12:36.807+10:00Flashback to 2008 - the Illumina GA "classic"<style>
h2 { font-size: larger; }
p { text-align: justify; }
</style>
<h2>Introduction</h2>
<p>
Throughout my bioinformatics career I have been fortunate to be around early adopters of the latest sequencing technologies.
Back in 2008 I worked in the Dept of Microbiology at Monash University who ran the
<a href="https://platforms.monash.edu/micromon/">Micromon</a> sequencing service. Micromon purchased Australia's
<i>first</i>
<a href="http://res.illumina.com/images/technology/genome_analyzer_lg.jpg">Illumina Genome Analyzer</a>. This was not a GAIIx or even GAII, it was what we now call a "GA Classic", not much more than an original
<a href="http://www.illumina.com/technology/next-generation-sequencing/solexa-technology.html">Solexa</a> instrument with upgraded rubber bands and some new stickers on it!
<h2>The data</h2>
<p>
The GA Classic supported single-end 36-bp reads when we got it, people prior to us only has 18-bp reads! The instrument had 8 lanes and produced 8 FASTQ files after 10 days of waiting. Each file had the name <tt>s_N_sequence.txt</tt> where <tt>N</tt> was the lane number.
<p>
I found one of the first runs we did dated March 2009. This data was for the small bacterium
<a href="http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=272843"><i>Pasteurella multocida PM70</i></a>.
In one lane we got a whopping 7,462,936 reads (36 bp) totalling 268,665,696 bp (268 Mbp) with average base quality Q30.
Here's the FASTQC plot:
<p>
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEi6JixJWYax0d5DZNmsBeio25t02bI3InhmsQCw3QAwCforlXuZYLQ2ISmIFjM088U4N2YMENZzFUeIkACprOcSLvNkitVSrnqEN5b186ZW1X7VDVo3dC20Fu8e5XJd4TmW-5VnXka32pen/s1600/Screen+Shot+2015-04-25+at+12.15.01+pm.png" imageanchor="1"><img width="100%" border="0" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEi6JixJWYax0d5DZNmsBeio25t02bI3InhmsQCw3QAwCforlXuZYLQ2ISmIFjM088U4N2YMENZzFUeIkACprOcSLvNkitVSrnqEN5b186ZW1X7VDVo3dC20Fu8e5XJd4TmW-5VnXka32pen/s1600/Screen+Shot+2015-04-25+at+12.15.01+pm.png" /></a>
<p>
Data of this length and quality would probably be filtered out in most modern pipelines!
But for us it was surprisingly sufficient (100x) to get a decent <i>de novo</i> assembly out of an early version of
<a href="http://en.wikipedia.org/wiki/Velvet_assembler">Velvet</a> (using k=29 and k=31) and annotate with an ancient predecessor of
<a href="http://github.com/tseemann/prokka/">Prokka</a>. And science pressed on.
<h2>Historical aside</h2>
<p>
Many of you will recall the rollercoaster changes in FASTQ quality encoding that Illumina put us through over the years, something that lead to me writing the first version of the
<a href="http://en.wikipedia.org/wiki/FASTQ_format">Wikipedia FASTQ page</a>, which was continually improved and extended by the amazing genomics bioinformatics community that exists out there.
<p>
Here's some other words to reminisce to: ELAND, Bustard, IPAR, MAQ, SSAHA.
<h2>Conclusion</h2>
<p>
Australia owes a lot to Micromon and <a href="http://med.monash.edu.au/microbiology/personnel/tech-supp-staff.html">Scott Coutts</a> the (extremely patient) scientist who had to figure out the original GA and then start all over again after every subsequent upgrade. He played a major role in training junior Illumina engineers who cut their teeth on this somewhat originally unreliable instrument before it eventually was upgraded to GAII and GAIIx (and eventually replaced by a MiSeq and NextSeq).
Torsten Seemannhttp://www.blogger.com/profile/12241185247897084810noreply@blogger.com2tag:blogger.com,1999:blog-1071661434473559589.post-36203630701134190052015-01-18T09:50:00.002+11:002015-01-18T10:48:21.317+11:00Big changes for the Victorian Bioinformatics Consortium <style>
h2 { font-size: larger; }
p { text-align: justify; }
</style>
<h2>Background</h2>
<p>
I have spent all 12 years of my postdoc life at the <a href="http://vicbioinformatics.com/">Victorian Bioinformatics Consortium</a>
(VBC) based at <a href="http://www.monash.edu/">Monash University</a> in Melbourne, Australia. The VBC was started by
<a href="http://www.med.monash.edu.au/microbiology/staff/coppel.html">Professor Ross Coppel</a> way back in 2002, a leader I greatly respect and thank for his vision and support of bioinformatics in Australia. Ross remains the director of the VBC to this day.
<p>
I began as a junior researcher at the VBC during the early well funded years (pre-NGS), and then as a senior researcher in the middle lean but productive years (NGS took off), and finally as scientific director during the last few years where I negotiated the VBC to become the Monash node of the greater <a href="http://vlsci.org.au">Victorian Life Sciences Computation Initiative</a> (VLSCI). The VLSCI was a joint initiative between the three biggest universities in Victoria, and it enabled us to triple in size to 6 bioinformaticians by funding 65% of our salaries. This enabled us to build a critical mass of staff with complementary expertise.
<h2>What's happened?</h2>
<p>
Unfortunately, the original VLSCI agreement ended on 31 Dec 2014, and Monash University declined to participate in the second round for various strategic and political reasons, despite all our attempts to persuade the Office of the Provost. This means the VBC is no longer eligible for VLSCI funding, so we can no longer operate as previously. The university has decided to start a separate dedicated bioinformatics core unit called the <a href="http://www.platformtechnologies.org/monash-bioinformatics-platform-16103/">Monash Bioinformatics Platform</a> (MBP).
<p>
I hoped the MBP could co-exist with the VBC/VLSCI but there were some incompatibilities. Understandably, the MBP will be service focussed and hence restricted to working on Monash-based projects only, and has little scope for bioinformatics research and tool development. The initial budget of the MBP was also insufficient to employ all existing VBC staff.
<p>My strongest collaborations are with <a href="http://www.microbiol.unimelb.edu.au/new_research/microbiology/stinear_novo.html">A/Prof Tim Stinear</a> and <a href="http://asmmeeting.theasm.org.au/invited-speakers-9/prof-benjamin-howden/">Prof Ben Howden</a>, both of whom were originally at Monash but now work at the <a href="http://www.unimelb.edu.au/">University of Melbourne</a>, and I have 4 NHMRC grants and an ARC LIEF grant with them. I want to work in microbial genomics which is only a minor interest to the MBP, and the Monash Department of Microbiology at Monash has no capacity or interest in employing me directly. The logical decision is to move.
<h2>What did you decide?</h2>
<p>
I have left Monash University. <i>Yes, really!</i> I started at Monash in 1992 as an undergraduate student, so that's 22 years or just shy of half of my life. I have accepted a position as Lead Bioinformatician at the VLSCI, including a promotion to Associate Professor. This is not a permanent or tenured position, but I did double my previous best contract length from 1 year to 2 years. I will remain an adjunct in the Department of Microbiology at Monash University, where I share an ARC grant with <a href="http://med.monash.edu.au/microbiology/staff/boyce.html">A/Prof John Boyce</a>.
<h2>What will you be working on?</h2>
<p>
My primary research role will be leading the Microbial/Non-Model Genomics theme of the VLSCI (the other themes are Cancer Genomics and Clinicogenomics). I will get to once again work closely with Tim Stinear and Ben Howden, and continue developing tools for microbial genomics analysis. One of my main goals is transitioning the <a href="http://www.mduphl.unimelb.edu.au/">Melbourne Diagnostic Unit Public Health Laboratory</a> (MDU) to a whole-genome sequencing and bioinformatics workflow, and then rolling this out to public health microbiology labs nationally. This new role will allow me to dedicate more time to the tools and methods that I think give most value back to the scientific community.
<h2>What about everyone else?</h2>
<p>
<ul>
<li>
Dieter Bulach has moved to the VLSCI, where he will working closely with me in MDU and Microbiology working on genomics projects.
<li>
Simon Gladman has also moved to the VLSCI and is continuing his work with the Dental School and the
<a href="http://genome.edu.au/">Genomics Virtual Laboratory</a> (GVL).
<li>
David Powell has taken a promotion and will head the new Monash Bioinformatics Platform (MBP).
<li>
Paul Harrison has taken a position with the MBP at Monash, and will continue to work with <a href="http://www.med.monash.edu.au/biochem/biographies/beilharz-twentytwelve.html">Traude Beilharz</a>.
<li>
Fernando Rossello has stayed at Monash but joined the lab of <a href="http://monash.edu/research/people/profiles/profile.html?sid=126943&pid=5780">Jose Polo</a> in the
<a href="http://www.armi.org.au/">Australian Regenerative Medicine Institute</a>.
<li>
Ross Coppel remains at Monash where he is the Deputy Dean and Dean of Research in the Faculty of Medicine.
</ul>
<h2>Where will you be located?</h2>
<p>I will regularly be at VLSCI headquarters, but I will spend most of my time at the new
<a href="http://www.doherty.edu.au/">Doherty Institute for Infection and Immunity</a> on Level 1 in the Microbial Diagnostic Unit (MDU). I share an office with Dieter Bulach, and we have a window view overlooking Grattan St where I can see trees and natural light!
<h2>What about the VBC web presence?</h2>
<p>
The <a href="http://vicbioinformatics.com/">VBC website</a> will be revamped to explain the situation and direct people appropriately. Legacy URLs, especially those published ones, will be redirected as needed. The group GitHub repositories will slowly be
migrated to personal repositories. All of us except Simon will still have our @monash.edu email addresses. The web services available on dna.med.monash.edu.au will remain for the time being, but eventually that server will be decommissioned, with some services being terminated and some being migrated to a new location.
<h2>Closing thoughts</h2>
<p>
I am sad that the VBC had to end so soon after gaining new momentum. The VBC team was a close-knit family, and I will miss working with Fernando and Paul, and especially David Powell who I've known for 27 years and respect immensely. Monash is very fortunate to have retained him because his leadership, planning and technical abilities will be essential to making the new MBP thrive.
<p>
I've slowly worked through the
<a href="http://en.wikipedia.org/wiki/K%C3%BCbler-Ross_model#Stages">stages of grief</a> and am now enthusiastic about starting a new era in the Parkville precinct which is the biggest biomedical research hub in Australia. I expect to have more time to work on tools for microbial genomics, and maybe even finally write the papers for some of them! I have a new amazing PhD student Jason Kwong, and a great bunch of colleagues at the VLSCI. I will continue to have a role in the Australian bioinformatics community, including supporting the new <a href="http://www.abacbs.org/">Australian Bioinformatics and Computational Biology Society</a> and the
<a href="http://bioinformatics.net.au/abic2014/">Australian Bioinformatics Conference</a>.
<p>
My final thanks go to my former boss, Prof Ross Coppel, who was ahead of his time at Monash in starting the VBC, and who took a chance on a young computer science PhD graduate who had never studied biology before, and supported him over many years because he believed in bioinformatics being a critical area of expertise Australia needed.
Torsten Seemannhttp://www.blogger.com/profile/12241185247897084810noreply@blogger.com2tag:blogger.com,1999:blog-1071661434473559589.post-87558682184668835912014-08-28T15:19:00.002+10:002014-10-19T16:19:38.728+11:00Visiting the UK in September 2014
<style>
table { border-collapse: collapse; }
table, th, td { border: solid black 1px; }
th, td { padding: 1ex; }
th { font-weight: bold; background: wheat; text-align: left; }
</style>
<p>
<h3>I am coming to the UK for 4 weeks in September!</h3>
<p>
Earlier in 2014 I decided to go to the Genome Informatics conference as I had never managed to get to it before. But I soon discovered a bunch of relevant meetings and workshops at the same time, and it was too hard to resist extending the trip.
<p>
I look forward to catching up with all my tweeps and fellow bioinformaticians!
<p>
<h3>Itinerary</h3>
<p>
<table>
<tr> <th>Date <th> Place <th> Activity
<tr> <td>1-3 Sep <td> Oxford <td> UK Genome Science 2014 (speaking)
<tr> <td>4-9 Sep <td> Birmingham <td> Visiting School of Biosciences (couldn't cope with ECCB too)
<tr> <td>10 Sep <td> Birmingham <td> Balti Bioinformatics "on air"
<tr> <td>11-12 Sep <td> York <td> Global Microbial Identifier 2014
<tr> <td>13-14 Sep <td> Birmingham <td> Weekend
<tr> <td>15-16 Sep <td> Birmingham <td> Midlands Microbiology Meeting 2014 (speaking)
<tr> <td>17 Sep <td> Birmingham <td> ngMicrobes Meeting
<tr> <td>18 Sep <td> Transit <td> Visit CAMI hackathon
<tr> <td>19-20 Sep <td> Cambridge <td> Ensembl Gene Annotation Workshop
<tr> <td>21-24 Sep <td> Cambridge <td> Genome Informatics 2014
<tr> <td>24 Sep <td> Cambridge <td> Illumina Inc.
</table>
<p>
<h3>Thanks</h3>
<p>
This megatrip wouldn't have been possible without the financial and other support of many people:
the Victorian Life Sciences Computation Initiative;
the Microbial Diagnostic Unit Public Health Laboratory;
the ngMicrobes Project;
Ross Coppel, Andrew Lonie, Helen Gardiner,
Ben Howden, Kim Barton,
David Sims, Gemma Shephard,
Laura Hubbard,
Allie Hardwick, Cathy Wardius,
Denise Carvalho-Silva,
Ian Henderson, and Nick Loman.Torsten Seemannhttp://www.blogger.com/profile/12241185247897084810noreply@blogger.com0tag:blogger.com,1999:blog-1071661434473559589.post-22204208258892117852014-05-25T10:36:00.000+10:002014-05-25T11:53:51.829+10:00Adding command line options to your shell scripts<style>
H2 { font-size: larger; }
P { text-align: justify; text-justify: inter-word; }
PRE { font-size: smaller; border: solid 1px Gray;
padding: 1ex; background-color:LightGray; }
</style>
<!-- ----------------------------------------------------------------------------- -->
<h2>Introduction</h2>
<p>
You have a new data set, which has a number of samples in it which need to be processed. You choose one sample to experiment with, and step by step you figure out a suitable list of commands to go from raw data to final result. You realise you have to do this analysis for every sample now, so choosing some way to automate the process is now the sensible thing to do.
<p>
There are many different ways to automate a set of commands in Unix. They can be full-blown workflow engines (Taverna, Kepler), pipeline systems (BPIPE, Ruffus, Rubra), dependency methods (make, Ant, Maven), or a scripting language (Bash, Python, Perl).
<p>
The oldest and arguably simplest method is to use a shell script. All this really means is putting the series of commands you need to run into a text file, and telling the shell to run them all. Although some may baulk at the idea of a shell script, they have the advantage of being very portable and lightweight, and have many modern features that people don't realise. I will assume the use of the BASH shell, as it is available on most Unix environments, and is default on Linux and MacOSX.
<!-- ----------------------------------------------------------------------------- -->
<h2>A shell script</h2>
<p>
Type the following into a text editor and save it with the name "biox":
<pre>
#!/bin/bash
echo -n "Hello $USER, today is "
date +%A
</pre>
<p>
You've created a BASH script called "biox" which is meant to print a greeting to the screen.
<h2>Running it</h2>
<p>
Let's try and run our new scripot:
<pre>
% biox
biox: command not found
</pre>
<p>
That didn't work. Ah, that's right, the current directory isn't in my PATH, so I need to refer to it directly:
<pre>
% ./biox
bash: ./biox: Permission denied
</pre>
<p>
That didn't work either. Ah yes, only files with "execute" permission can be run:
<pre>
% chmod +x biox
% ./biox
Hello torsten, today is Sunday
</pre>
<p>
Success! An alternative way to run it is to pass it directly to the BASH command as an input script:
<pre>
% bash biox
Hello torsten, today is Sunday
</pre>
<p>
The advantage of making it executable is that it looks and feels like a standard Unix command, and you don't have to remember what scripting language to run it with. The shell figures that out automatically for you from the magic first line <code>#!/bin/bash</code> of the script.
<!-- ----------------------------------------------------------------------------- -->
<h2>Script Parameters</h2>
<p>
The motivation for writing a shell script was to automate the same set of commands
for many samples. This means we need some way to tell it which data files to run
on each time, without having to create a separate script for each sample.
<p>
Imagine we have lots of genome sequence runs, each one for a different Staphylococcus isolate from a hospital MRSA outbreak. Each sample's data is a paired-end Illumina run conisting of two files: <code>Strain_R1.fastq.gz</code> and <code>Strain_R2.fastq.gz</code>. Below is a script called <code>assemble</code>
with 4 parameters which will automate the assembly of a given isolate:
<pre>
#!/bin/bash
if [ $# -lt 4 ]; then
echo "Usage: $0 outputFolder kmerValue Read1 Read2"
exit 1
fi
DIR="$1"
KVALUE="$2"
LEFT="$3"
RIGHT="$4"
velveth "$DIR" "$KVALUE" -shortPaired -fmtAuto -separate "$LEFT" "$RIGHT"
velvetg "$DIR" -exp_cov auto -cov_cutoff auto -very_clean yes
echo "Results are in: $DIR"
</pre>
<p>
The first "if" block checks to see that we provided 4 parameters, and if not, it prints a usage message and exists. The next 4 lines copy the 4 positional command line parameters into permanent, more understandable variables. The next 2 lines run velveth and velvetg accordingly, using as flexible options as possible. The final line just prints a message stating where the results are.
<pre>
% ./assemble
Usage: ./assemble outputFolder kmerValue Read1 Read2
% ./assemble MRSA_J19d 51 J19d_R1.fq.gz J19d_R1.fq.gz
(lots of velveth output here)
(lots of velvetg output here)
Results are in: MRSA_J19d
</pre>
<p>
It is easy to envisage modifying this script to include pre-steps like read clipping, filtering and stitching; and post-steps like gap-filling and scaffolding. The opportunities for automation are endless.
<!-- ----------------------------------------------------------------------------- -->
<h2>Script Options</h2>
<p>
Clearly the ability to pass positional command line parameters to your script turns
it from a bunch of fixed commands into a more generic re-usable tool. To make it even more flexible however you need command line options. At this point, many people would give up on BASH and move to a scripting language such as Python or Perl. However you may be surprised to know that BASH has
<a href="http://wiki.bash-hackers.org/howto/getopts_tutorial">inbuilt support</a>
for the <code>getopt</code> style of command line options!
<p>
Below is a newer version of our assembly script. It only has 3 mandatory parameters now (folder, R1, R2). The kmerValue is now default to 51, but can be changed using the -k option. We also add a new option -c to set the coverage cutoff, which defaults to auto.
<pre>
#!/bin/bash
# set our defaults for the options
KVALUE=51
CUTOFF=auto
# parse the options
while getopts 'c:k:' opt ; do
case $opt in
c) CUTOFF=$OPTARG ;;
k) KVALUE=$OPTARG ;;
esac
done
# skip over the processed options
shift $((OPTIND-1))
# check for mandatory positional parameters
if [ $# -lt 3 ]; then
echo "Usage: $0 [options] outputFolder Read1 Read2"
echo "Options: -k kmervalue (def: $KVALUE) | -c cov_cutoff (def: $CUTOFF)"
exit 1
fi
DIR="$1"
LEFT="$2"
RIGHT="$3"
# do the assembly
echo "Assembling with K=$KVALUE and cutoff=$CUTOFF"
velveth "$DIR" "$KVALUE" -shortPaired -fmtAuto -separate "$LEFT" "$RIGHT"
velvetg "$DIR" -exp_cov auto -cov_cutoff "$CUTOFF" -very_clean yes
echo "Results are in: $DIR"
</pre>
<p>
As you can see, adding command line options requires little effort, and makes the script more flexible and professional.
<pre>
% ./assemble
Usage: ./assemble [options] outputFolder Read1 Read2"
Options: -k kmervalue (def: 51) | -c cov_cutoff (def: auto)"
% ./assemble -k 83 -c 3 MRSA_J19d J19d_R1.fq.gz J19d_R1.fq.gz
Assembling with K=83 and cutoff=3
(lots of velveth output here)
(lots of velvetg output here)
Results are in: MRSA_J19d
</pre>
<!-- ----------------------------------------------------------------------------- -->
<h2>Error handling</h2>
<p>
The example scripts in this post only do a small amount error checking - they ensure the correct number of command line parameters were provided, but that is it. It doesn't check that all the options and parameters were valid eg. that the kmer value was an integer and not too small or too big, or that the read files actually existed and were readable, or that the output directory existed already or not. Neither did it check that the velveth and velvetg commands successfully ran or not. Nor did we catch the situation where the user pressed CTRL-C in the middle of our script!
<p>
The simplest thing you can do is add the following line to the top of your script:
<pre>
#!/bin/bash
set -e
</pre>
<p>
This will cause the script to exit/fail if any of the commands that are run within the script fail (ie. they return a non-zero exit code). More detailed error handling is beyond the scope of this article but it something you should consider when automating the processing of huge data sets.
<!-- ----------------------------------------------------------------------------- -->
<h2>Conclusion</h2>
<p>
BASH scripts are still useful in today's bioinformatics world. They are a simple, portable way to automate your analyses. Smart use of command line parameters and command line options will make them even more flexible and potentially shareable with
other bioinformaticians. Add in some error handling and defensive programming and you will produce quality tools without the need for higher level or more advanced scripting systems.
<!-- ----------------------------------------------------------------------------- -->
<h2>Further reading</h2>
<ul>
<li><a href='http://steve-parker.org/sh/bourne.shtml'>
Introduction to BASH from the author himself</a>
<li><a href='http://www.gnu.org/software/bash/manual/bashref.html'>
BASH Reference Manual</a>
<li><a href='http://mywiki.wooledge.org/BashGuide'>
The BASH Guide</a>
<li><a href='http://stackoverflow.com/questions/11279423/bash-getopts-with-multiple-and-mandatory-options'>
BASH getopts with multiple and mandatory options</a>
<li><a href='https://google-styleguide.googlecode.com/svn/trunk/shell.xml'>
Google Shell Style Guide</a>
</ul>
Torsten Seemannhttp://www.blogger.com/profile/12241185247897084810noreply@blogger.com6tag:blogger.com,1999:blog-1071661434473559589.post-15989202851177810862013-10-06T15:15:00.001+11:002013-10-06T19:34:39.040+11:00Understanding SNPs and INDELs in microbial genomes<style>
H2 { font-size: larger; }
</style>
<h2>Introduction</h2>
<p>
Variants are differences between two genomes.
Here I describe two important types of nucleotide-level variants (SNPs and INDELs)
and how they affect microbial genomes.
</p><h2>SNPs</h2>
<p>
A <a href="http://en.wikipedia.org/wiki/Single-nucleotide_polymorphism">SNP</a>
is a <i>single nucleotide polymorphism</i> (pronounced "snip"). This is when there is
single base which differs between two genomes, and the DNA around that base
is otherwise unchanged.
</p><pre>Genome 1 | DNA | ATGCTATAGTAAATCTGCGCTAGCT
Genome 2 | DNA | ATGCTATAGTAAATGTGCGCTAGCT
|
SNP(C=>G)
</pre>
<p>
In coding-dense genomes like microbes, most SNPs will be within protein coding regions.
Thus the SNP will change a codon, and potentially change the amino acid it codes for.
If the amino acid coded for does not change, it is called a <i>synonymous</i> SNP
(as the codon is a 'synonym' for the amino acid). If it does change, it is called
a <i>non-synonymous</i> SNP.
</p><pre>Genome 1 | DNA | ATG AAA GTT GAT GAC CAG CAT TCC CCA TGA
Genome 2 | DNA | ATG AAA GTC GAT GAC CAG CAT TAC CCA TGA
..| .|.
SNP(T=>C) SNP(C=>A)
..| .|.
Genome 1 | AA | M K V D D Q H S P *
Genome 2 | AA | M K V D D Q H Y P *
| |
SYN NON-SYN
</pre>
<p>
A non-synonymous SNP can drastically alter the function of a protein
because sometimes a single amino acid difference can modify the structure/shape of a protein.
It could even affect the RNA transcript itself, causing it to be translated
at lower efficiency or not at all. SNPs in promoter regions (-35, -10) and the ribosome binding site
(RBS) can have similar effects.
</p><p>
A good rule of thumb is that SNPs in the 3rd position in a codon often produce synonymous SNPs,
due to the particular pattern of degeneracy in the
<a href="http://en.wikipedia.org/wiki/Genetic_code#Degeneracy">genetic code</a>.
If two SNPs occur right next to each other, the variant is sometimes called a
<i>multiple nucleotide polymorphism</i> (MNP).
</p><h2>INDELs</h2>
<p>
An INDEL (<i>INsertion/DELetion</i>) is where a single base has been deleted, or inserted into one genome relative to another. It is a symmetrical relationship, as a deletion in one corresponds to an insertion in another. I reckon it should be called a <i>deletion/insertion polymorphism</i> (DIP) too, so we can all snack on SNPs and DIPs :-)
</p><pre> DEL(A)
|
Genome 1 | DNA | ATGCTATAGTAA-TCTGCGCTAGCT
Genome 2 | DNA | ATGCTATAGTAAATGTGCGCTAGCT
|
INS(A)
</pre>
<p>
While a SNP will either change a protein slightly or not at all, an INDEL will nearly always have a
drastic affect on a protein. Because codons are groups of 3 nucleotides, removing/adding 1 nucleotide
messes everything up; this is called a
<a href="http://en.wikipedia.org/wiki/Frameshift_mutation">frame-shift mutation</a>.
This usually results in either a protein being extended, or truncated.
</p><pre>Genome 1 | DNA | ATG AAA GTT GAT GAC CAG CAT TCC CCA TGA
Genome 1 | AA | M K V D D Q H S P *
Genome 2 | DNA | ATG AAA GTC -AT GAC CAG CAT TAC CCA TGA
|
DEL(G)
|
Genome 2 | DNA | ATG AAA GTC ATG ACC AGC ATT ACC CAT GA? ??? ??? ???
Genome 2 | AA | M K V M T S I T H X X X X
|
STOP Loss & read-through
</pre>
<p>
In the previous case, the protein was extended into a new frame, causing it to
have a different 3' end than normal. It will eventually hit another stop codon
just by chance. In the case below, if a premature STOP codon is introduced, then we end up with a
shorter reading frame.
</p><pre>Genome 3 | DNA | ATG AAA GTC GA<u>A</u>T GAC CAG CAT TAC CCA TGA
|
INS(A)
|
Genome 3 | DNA | ATG AAA GTC GAA TGA CCA GCA TTA CCC ATG
Genome 3 | AA | M K V E * P A L P M
|
STOP Gain & truncation
</pre>
<p>
Because the terminator sequence is no longer where it
needs to be, these genes may not every be transcribed, or translated. In that
case they are called <a href="http://en.wikipedia.org/wiki/Pseudogene">pseudo-genes</a>.
</p><p>
If multiple deletions (or multiple insertions) occur together,
it is sometimes called a micro-indel (or micro-insertion).
A micro-INDEL of length 3 occasionally occurs in bacterial evolution,
as it keeps the protein translation in frame.
</p><h2>Structural Variation</h2>
<p>
SNPs and INDELs are about low-level genomic variation. It is also possible to look at
structural variants which affect the genome at larger scales. Events like gene duplications,
tandem repeats, transposon insertions, inversions, and other chromosomal
rearrangements are all important to consider, but this post will leave those issues for
another day.
</p><h2>Conclusion</h2>
<p>
SNPs and INDELs are small differences between genomes. They are important drivers of bacterial
evolution, by modifying how or whether genes are transcribed and translated. In my next post I
will introduce my new tool Snippy for discovering these differences efficiently.
</p>Torsten Seemannhttp://www.blogger.com/profile/12241185247897084810noreply@blogger.com8tag:blogger.com,1999:blog-1071661434473559589.post-70106081690928747022013-08-30T06:29:00.000+10:002013-09-03T14:12:28.042+10:00How Spades differs from Velvet
<h2>Introduction</h2>
<p>
Those of us working in bacterial genomics are all to familiar with <i>de novo</i> genome assembly.
One of the first accessible and practical tools for bacterial genome assembly was
<a href='http://www.ebi.ac.uk/~zerbino/velvet'>Velvet</a>.
My group use Velvet a lot, and wrote the popular
<a href='http://vicbioinformatic.com/'>VelvetOptimiser</a> software.
<p>
Since then, many alternatives to Velvet have appeared, including
ABYSS, SOAPdenovo, ALLPATH-LG, SGA, Ray, and many others.
The motivation for some of these alternatives was to improve performance
and decrease RAM usage when assembling large, polyploid organisms which
Velvet was not really designed to handle.
<p>
Despite these alternatives, Velvet has still thrived due to it having
a strong user community, and still giving good, usable assemblies.
But there is always room for improvement and new ideas, and I believe
an excellent option for bacterial assemblies currently is
<a href='http://bioinf.spbau.ru/spades'>SPAdes</a>. It recently ranked
very well in the <a href='http://ccb.jhu.edu/gage_b/'>GAGE-B assessment</a>
and in this post I will explain its relationship to Velvet in broad terms.
</p>
<h2>What's the same?</h2>
<p>
<a href='http://bioinf.spbau.ru/spades'>SPAdes</a>
is a
<a href='http://thegenomefactory.blogspot.com.au/2013/08/how-to-pronounce-de bruijn.html'>de Bruijn</a>
graph based assembler, just like most short read assemblers, including Velvet. It breaks reads into
fixed-size <a href='http://en.wikipedia.org/wiki/K-mer'>k-mers</a>, builds a graph, cleans the graph, then finds paths through the graph. These paths end up as contigs.
<p>
SPAdes was originally intended for assembling MDA data. This is data that comes from single-cell sequencing using the
<a href='http://en.wikipedia.org/wiki/Multiple_displacement_amplification'>multiple displacement amplification</a> method for tiny amounts of input DNA. This produces wildly varying genome coverage, something which existing assemblers were not able to deal with well. But SPAdes by default now works with regular data, but it is neat that it can support MDA when required.
<p>
The target data source for SPAdes is Illumina reads. Like all de Bruijn graph based assemblers, they work best with shorter, high quality reads where indels are rare. For PGM and 454 data I would look elsewhere.
<h2>What's different?</h2>
<p>
The authors would argue, and the GAGE-B assessment supports the argument, that SPAdes does a better job than Velvet and other assemblers on microbial genome data. I have not had extensive experience with it yet, but have used it enough to now recommend it to others and trust it on my own data sets (well, as much as I trust any assembler!).
<p>
But there is a good reason SPAdes does better. It is really multiple tools in one. This integrated approach makes things much simpler to incorporate in pipelines. Here are the key steps SPAdes makes, as best I understand them:
<ol>
<li>
Read error correction based on k-mer frequencies using
<a href='http://genomebiology.com/1471-2164/14/S1/S7'>BayesHammer</a>
<li>
De Bruijn graph assembly at <em>multiple</em> k-mer sizes, not just a single fixed one.
<li>
Merging of different k-mer assemblies (good for varying coverage)
<li>
Scaffolding of contigs from PE/MP reads
<li>
Repeat resolution from PE/MP data using
<a href='http://bioinf.spbau.ru/rectangles'>rectangle graphs</a>
<li>
Contig error correction based on aligning the original reads with
<a href='http://bio-bwa.sourceforge.net/'>BWA</a> back to contigs
</ol>
<p>
Just like Velvet, it can use multiple threads for some parts of the algorithm. SPAdes produces a final "contigs.fasta" and "scaffolds.fasta" file, and a detailed log file so you can reconstruct your results. I think it is using more sophisticated dynamic methods for estimating k-mer coverage and cutoffs. Of course it takes longer to run than Velvet, but it is doing a lot more than Velvet does.
<h2>Conclusion</h2>
<p>
The SPAdes software is easy to install, has a nice clean interface, and follows my
<a href='http://thegenomefactory.blogspot.com.au/2013/08/minimum-standards-for-bioinformatics.html'>minimum standards</a> for bioinformatics software. The authors are actively developing it, and respond to bug reports and questions. The results are good, and the computational requirements are reasonable. It is well worth trying on your own microbial data. So go and <a href='http://bioinf.spbau.ru/spades'>download it</a>,
try it out, and <a href='mailto:spades.support@bioinf.spbau.ru'>email your feedback</a> today.
Torsten Seemannhttp://www.blogger.com/profile/12241185247897084810noreply@blogger.com14tag:blogger.com,1999:blog-1071661434473559589.post-25149304256730432432013-08-25T10:09:00.001+10:002013-08-25T17:26:04.513+10:00Paired-end read confusion - library, fragment or insert size?<h2>Introduction</h2>
<p>
When you do an Illumina sequencing run, you need to choose between single-end (SE) or paired-end (PE) sequencing.
When sequencing, we chop up our DNA into small fragments, and then ligate some adaptors. Then, for SE, we only sequence <em>one</em> end of a DNA fragment. For PE, we sequence <em>both</em> ends of the <em>same</em> fragment:
</p>
<pre>
fragment ========================================
fragment + adaptors ~~~========================================~~~
SE read --------->
PE reads R1---------> <---------R2
unknown gap ....................
</pre>
<p>
The two reads you get from PE sequencing are referred to as R1 and R2, and they come from the same piece of DNA. Usually the length of the fragment is much longer than the length of R1+R2, so there is a "gap" in between them.
Although we don't know the sequence of DNA in between R1 and R2, we have still gained useful information from the knowledge that R1 and R2 are next to each other with a known orientation and distance apart.
</p>
<h2>Mind the gap</h2>
<p>
There is a lot of confusion about the gap of unknown bases. You will encounter terms like "insert size", "fragment size", "library size" and variations thereof. The term "insert" comes from a time before NGS existed, when cloning DNA in <i>E.coli</i> vectors was standard business.
</p>
<pre>
PE reads R1---------> <---------R2
fragment ~~~========================================~~~
insert ========================================
inner mate ....................
</pre>
<p>
The main confusion is with "insert size". The name itself suggests it is the unknown gap because it is "inserted" between R1 and R2, but this is misleading. It is more accurate to think of the insert as the piece of DNA inserted between the adaptors which enable amplification and sequencing of that piece of DNA. So the "insert" actually encompasses R1 and R2 as well as the unknown gap between them. The name for the gap itself is better named "inner mate distance" because it is self-descriptive and can vary depending on what read lengths you sequenced a DNA library with.
</p>
<h2>Overlapping reads</h2>
<p>
The Illumina MiSeq instrument has added to the confusion recently. Firstly, it can produce PE reads of length 250bp. Secondly, the Nextera preparation method is sensitive and can produce a lot of small fragments, shorter than 500bp. This results in R1 and R2 actually overlapping each other!
<pre>
fragment ~~~========================================~~~
insert ========================================
R1 ------------------------->
R2 <-----------------------
overlap ::::::::::
stitched SE read --------------------------------------->
</pre>
<p>
This can actually be a desirable outcome, as you can
<a href="http://thegenomefactory.blogspot.com.au/2012/11/tools-to-merge-overlapping-paired-end.html">stitch</a> R1 and R2 together to make a super-long SE read, with extra confidence of the middle bases from consensus of the overlapping sections of R1 and R2.
<h2>Adaptor read-through</h2>
<p>
If the distribution of fragment sizes is too low, or very wide, you can get the situation where not only do the reads overlap, but they are longer than the fragment itself! This causes R1 and R2 to read into the adaptors:
<pre>
tiny fragment ~~~~========================~~~~
insert ========================
R1 -------------------------->
R2 <--------------------------
read-through !!! !!!
</pre>
<p>
If your MiSeq is configured properly, it will automatically trim/mask any adaptor sequence.
This will be obvious by your FASTQ file containing reads of different length, or by the presence of lots of Ns at the 5' end of your reads. If it is not configured properly, you will get adaptors in your reads, and these will cause all sorts of problems with downstream applications. You should remove these using a read trimming tool.
<h2>Conclusion</h2>
<p>Paired-end reads are a neat molecular biology trick. Remember that "insert" refers to the DNA fragment between the adaptors, and not the gap between R1 and R2. Instead we refer to that as the "inner mate distance". In some cases, when reads overlap, the inner mate distance can actually be negative. If you are using MiSeq data, you need to be vigilant about checking for adaptor read-through and overlapping reads.
<h2>References</h2>
<ul>
<li><a href='http://seqanswers.com/forums/showthread.php?t=13098'>SeqAnswers.com #13098</a>
<li><a href='http://seqanswers.com/forums/showthread.php?t=15511'>SeqAnswers.com #15511</a>
</ul>
Torsten Seemannhttp://www.blogger.com/profile/12241185247897084810noreply@blogger.com95tag:blogger.com,1999:blog-1071661434473559589.post-54467960628857200642013-08-09T09:58:00.002+10:002013-08-09T09:58:46.492+10:00Minimum standards for bioinformatics command line tools<div>
<span style="font-family: inherit;"><br /></span>
<span style="font-family: inherit;">I don't consider myself a good software engineer, or a good tester, a good documenter, or even that good a programmer. But I have used, and (tried to) installed a LOT of bioinformatics software over the last 12 years. I've also released a lot of software, and I try to make it as painless to use as possible. </span><span style="font-family: inherit;">From these experiences, I bring you my "Ten rules for bioinformatics software".</span></div>
<div>
<b><span style="font-family: inherit;"><br /></span></b>
<b><span style="font-family: inherit;"><br /></span></b>
<b><span style="font-family: inherit;">1. Print something if no parameters are supplied</span></b></div>
<div>
<b><span style="font-family: inherit;"><br /></span></b></div>
<div>
<span style="font-family: inherit;">Unless your tool is a filter which works by manipulating stdin to stdout, you should always print out something (some help text, ideally) if the user runs your tool without all the required parameters. Just exiting quietly isn't helping anyone.</span></div>
<div>
<span style="font-family: inherit;"><br /></span></div>
<div>
<span style="font-family: Courier New, Courier, monospace;">% biotool</span></div>
<div>
<span style="font-family: Courier New, Courier, monospace;">Please use the --help option to get usage information.</span></div>
<div>
<span style="font-family: inherit;"><br /></span></div>
<div>
<b><span style="font-family: inherit;">2. Always have a "-h" or "--help" switch</span></b></div>
<div>
<span style="font-family: inherit;"><br /></span></div>
<div>
<span style="font-family: inherit;">The Unix tradition is for all commands to have a "-h" or "--help" switch, which when invoked, prints usage information about the command. Most languages come with a getopt() type library, so there is no excuse for not supporting this.</span></div>
<div>
<span style="font-family: inherit;"><br /></span></div>
<div>
<span style="font-family: Courier New, Courier, monospace;">% biotool -h</span></div>
<div>
<span style="font-family: Courier New, Courier, monospace;">Usage: biotool [options] <file.fq></span></div>
<div>
<span style="font-family: Courier New, Courier, monospace;">Options:</span></div>
<div>
<span style="font-family: Courier New, Courier, monospace;">--rc reverse complement</span></div>
<div>
<span style="font-family: Courier New, Courier, monospace;">--trim nn trim <nn> bases from 3' end first</span></div>
<div>
<span style="font-family: Courier New, Courier, monospace;">--mask remove vector sequence contaminant</span></div>
<div>
<span style="font-family: inherit;"><br /></span>
<span style="font-family: inherit;"><br /></span></div>
<div>
<b><span style="font-family: inherit;">3. Have a "-v" or "--version" switch</span></b></div>
<div>
<span style="font-family: inherit;"><br /></span></div>
<div>
<span style="font-family: inherit;">Many bioinformatics tools today are used as part of larger pipelines, or put into the Galaxy toolshed. Because compatibility is dependent on the version of your tool being used, you should have a simple, machine-parseable way to identify what version of tool you have.</span></div>
<div>
<span style="font-family: inherit;"><br /></span></div>
<div>
<span style="font-family: Courier New, Courier, monospace;">% biotool --version</span></div>
<div>
<span style="font-family: Courier New, Courier, monospace;">biotool 1.3a</span></div>
<div>
<span style="font-family: inherit;"><br /></span>
<span style="font-family: inherit;"><br /></span></div>
<div>
<b><span style="font-family: inherit;">4. Use stderr for messages and errors</span></b></div>
<div>
<span style="font-family: inherit;"><br /></span></div>
<div>
<span style="font-family: inherit;">If you need to print an error message, are just printing out progress or log information, try and use stderr rather than stdout. Try to reserve stdout for use as your output channel, so that it can be used in Unix pipes to avoid temporary files. </span></div>
<div>
<span style="font-family: inherit;"><br /></span></div>
<div>
<span style="font-family: Courier New, Courier, monospace;">% biotool reads.fq | fq2fa > clean.fq</span></div>
<div>
<span style="font-family: Courier New, Courier, monospace;">biotool: processing reads.fq</span></div>
<div>
<span style="font-family: Courier New, Courier, monospace;">fq2fa: converted 423421 reads</span></div>
<div>
<span style="font-family: inherit;"><br /></span></div>
<div>
<div>
<div>
<b><span style="font-family: inherit;"><br /></span></b>
<b><span style="font-family: inherit;">5. Validate your parameters</span></b></div>
<div>
<span style="font-family: inherit;"><br /></span></div>
<div>
<span style="font-family: inherit;">If you have command line options, do some validation or sanity checking on them before letting them through to your critical code. Many getopt() libraries support basic validation, but ultimately it is not that difficult to have a preamble with some "if not XXX { print ERROR ; exit }" clauses.</span></div>
<div>
<span style="font-family: inherit;"><br /></span></div>
<div>
<span style="font-family: Courier New, Courier, monospace;">% biotool --trim -3 reads.fq </span></div>
</div>
<div>
<span style="font-family: Courier New, Courier, monospace;">Error: --trim must be an integer > 0</span></div>
<div>
<span style="font-family: inherit;"><br /></span>
<span style="font-family: inherit;"><br /></span></div>
<div>
<div>
<div>
<b><span style="font-family: inherit;">6. Don't hard-code any paths</span></b></div>
<div>
<span style="font-family: inherit;"><br /></span></div>
<div>
<span style="font-family: inherit;">Often the tool you write depends on some other files, such as config files or database/model files. The easiest, but wrong and annoying, thing to do is just put</span></div>
<div>
<span style="font-family: inherit;"><br /></span></div>
<div>
<span style="font-family: Courier New, Courier, monospace;">% biotool --mask reads.fq </span></div>
</div>
<div>
<span style="font-family: Courier New, Courier, monospace;">Error: can't load /home/steven/work/biotool/data/vector.seq</span></div>
<div>
<span style="font-family: Courier New, Courier, monospace;"># ARRRGGGGHHH!</span></div>
<div>
<span style="font-family: inherit;"><br /></span>
<br />
<div>
<div>
<b><span style="font-family: inherit;">7. Don't pollute the command-line name space</span></b></div>
<div>
<span style="font-family: inherit;"><br /></span></div>
<div>
<span style="font-family: inherit;">You've come up with a new tool called "BioTool". The command you want everyone to invoke is called "biotool", but it is just a master script which runs lots of other tools. Unfortunately you used lots of generic names like "fasta2fastq", "convert", "filter" .. and so on, and you've put them all in the same folder at the main "biotool" script. So when I install BioTool, my PATH gets filled with rubbish. Please don't do this.</span></div>
<div>
<span style="font-family: inherit;"><br /></span>
<br />
<div>
<span style="font-family: Courier New, Courier, monospace;">% ls -1 /opt/BioTool/</span><br />
<span style="font-family: Courier New, Courier, monospace;">biotool </span><br />
<span style="font-family: Courier New, Courier, monospace;">convert # whoops, clashes with ImageMagick!</span><br />
<span style="font-family: Courier New, Courier, monospace;">load-hash.py # hello Titus :-)</span><br />
<span style="font-family: Courier New, Courier, monospace;">filter</span></div>
<div>
</div>
<span style="font-family: Courier New, Courier, monospace;">diff # whoops, clashes with standard Unix tool!</span><br />
<span style="font-family: Courier New, Courier, monospace;">test.sh # <face-palm></span></div>
</div>
<div style="-webkit-text-stroke-width: 0px; color: black; font-style: normal; font-variant: normal; font-weight: normal; letter-spacing: normal; line-height: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px;">
<div style="margin: 0px;">
<span style="font-family: inherit;"><br /></span></div>
<div style="margin: 0px;">
<span style="font-family: inherit;">The first solution is to prefix all your sub-tools and helper scripts with "biotool". The second solution, if they are scripts only, is to not make them executable (so they don't go in PATH) and invoke the via the interpreter (perl, python, ...) explicitly from biotool. The third solution is too put them all in a separate folder (eg. auxiliary/, scripts/ ...) and explicitly call them (but take note of #6 above).</span></div>
<div style="margin: 0px;">
<span style="font-family: inherit;"><br /></span></div>
</div>
</div>
<div>
<div style="-webkit-text-stroke-width: 0px; color: black; font-style: normal; font-variant: normal; font-weight: normal; letter-spacing: normal; line-height: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px;">
<div>
<div>
<b><span style="font-family: inherit;"><br />8. Don't distribute bare JAR files</span></b><br />
<b><span style="font-family: inherit;"><br /></span></b></div>
<div>
<span style="font-family: inherit;">If your tool is written in Java and is distributed as a JAR file, please write a simple shell wrapper script to make it simple to invoke. The three lines below are all you need (in the simple case) and you will make your users much happier.</span></div>
<div>
<span style="font-family: inherit;"><br /></span></div>
<div>
<span style="font-family: Courier New, Courier, monospace;">#!/bin/bash</span><br />
<span style="font-family: Courier New, Courier, monospace;">PREFIX=$(dirname $0)</span><br />
<span style="font-family: Courier New, Courier, monospace;">java -Xmx500m -jar $PREFIX/BioTool.jar $*</span><br />
<br /></div>
</div>
<div style="-webkit-text-stroke-width: 0px; color: black; font-style: normal; font-variant: normal; font-weight: normal; letter-spacing: normal; line-height: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px;">
<div>
<div>
<div>
<div style="-webkit-text-stroke-width: 0px; color: black; font-family: Times; font-size: medium; font-style: normal; font-variant: normal; font-weight: normal; letter-spacing: normal; line-height: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px;">
<div style="margin: 0px;">
<b><br />9. Check that your dependencies are installed</b></div>
</div>
</div>
<div>
<span style="font-family: inherit;"><br /></span>
<br />
<div>
<span style="font-family: inherit;">I've installed BioTool, and I start running it, and all looks good. Then 2 hours later it spits out an error like "error: can't run sff2CA". This could all be avoided if biotool checked all the external tools it needed before it commenced, and save your users associating your software with pain. </span></div>
<div>
</div>
<span style="font-family: Courier New, Courier, monospace;"><br /></span>
<span style="font-family: Courier New, Courier, monospace;">% biotool --stitch R1.fq R2.fq</span><br />
<span style="font-family: Courier New, Courier, monospace;">This is biotool 1.3a</span><br />
<span style="font-family: Courier New, Courier, monospace;">Loaded config</span><br />
<span style="font-family: Courier New, Courier, monospace;">Checking for 'bwa': found /usr/bin/bwa</span><br />
<span style="font-family: Courier New, Courier, monospace;">Checking for 'samtools': ERROR - could not find 'samtools'</span><br />
<span style="font-family: Courier New, Courier, monospace;">Exiting.</span></div>
</div>
<div>
</div>
<div style="margin: 0px;">
<br /></div>
</div>
<div>
<div style="-webkit-text-stroke-width: 0px; color: black; font-family: Times; font-size: medium; font-style: normal; font-variant: normal; font-weight: normal; letter-spacing: normal; line-height: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px;">
<div style="-webkit-text-stroke-width: 0px; color: black; font-family: Times; font-size: medium; font-style: normal; font-variant: normal; font-weight: normal; letter-spacing: normal; line-height: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px;">
<div style="margin: 0px;">
<b><br />10. Be strict if you are still a Perl tragic like me</b></div>
</div>
</div>
</div>
<div>
<div style="margin: 0px;">
<span style="font-family: inherit;"><br /></span></div>
<div style="margin: 0px;">
<span style="font-family: inherit;">If you're old like me and Perl is still your native tongue, at least play it a little bit safer by starting all your scripts with the following lines:</span></div>
</div>
<div>
<div style="margin: 0px;">
<span style="font-family: inherit;"><br /></span></div>
<div style="margin: 0px;">
<span style="font-family: Courier New, Courier, monospace;">#!/usr/bin/env perl</span></div>
</div>
<div>
<div style="margin: 0px;">
<span style="font-family: Courier New, Courier, monospace;">use strict;</span></div>
<div style="margin: 0px;">
<span style="font-family: Courier New, Courier, monospace;">use warnings;</span></div>
<div style="margin: 0px;">
<span style="font-family: Courier New, Courier, monospace;">use Fatal;</span></div>
<div style="-webkit-text-stroke-width: 0px; color: black; font-style: normal; font-variant: normal; font-weight: normal; letter-spacing: normal; line-height: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px;">
<div style="margin: 0px;">
</div>
<div style="-webkit-text-stroke-width: 0px; color: black; font-family: Times; font-size: medium; font-style: normal; font-variant: normal; font-weight: normal; letter-spacing: normal; line-height: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px;">
</div>
<br />
<div style="-webkit-text-stroke-width: 0px; color: black; font-family: Times; font-size: medium; font-style: normal; font-variant: normal; font-weight: normal; letter-spacing: normal; line-height: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px;">
<div style="margin: 0px;">
<b><span style="font-family: inherit;"><br />I'll shut up now :-)</span></b></div>
</div>
<div style="margin: 0px;">
<b><br /></b></div>
</div>
</div>
</div>
</div>
</div>
</div>
</div>
Torsten Seemannhttp://www.blogger.com/profile/12241185247897084810noreply@blogger.com8tag:blogger.com,1999:blog-1071661434473559589.post-42316695634312232402013-08-01T16:24:00.001+10:002013-08-01T16:24:31.031+10:00How to pronounce "de Bruijn"<br />
For those who work in bioinformatics the phrase "de Bruijn graph" will be familiar. Although it technically refers to a mathematical construct, it is commonly used in bioinformatics to refer to the data structure used to store DNA read connections in many de novo assembly algorithms such as EULER (*), Velvet, Gossamer and lots of other implementations.<br />
<br />
Although we all agree the de Bruijn graph is a "really neat idea", what we don't seem to agree on is how to pronounce it!<br />
<br />
Now, the de Bruijn graph is named after the mathematician <a href="http://en.wikipedia.org/wiki/Nicolaas_Govert_de_Bruijn" target="_blank">Nicolaas Govert de Bruijn</a>. Nicolaas was from the Netherlands, so he is Dutch. The word "bruijn" essentially means the colour brown - although modern spelling would be "bruin".<br />
<br />
Here are the various ways I have heard it pronounced, some of them in successive talks at ISMB 2013 in the same session even:<br />
<br />
<ul>
<li>broon</li>
<li>broo-en, brewin' </li>
<li>bra-jen, brar-djen</li>
<li>brin</li>
<li>brun</li>
<li>bruggin, bruggen</li>
<li>broin, broyn</li>
</ul>
<br />
<div>
<b>All of these are wrong.</b> Even this <a href="http://www.biostars.org/p/7186/" target="_blank">BioStar post</a> appears to be wrong...</div>
<div>
<br /></div>
<div>
<b>The closest sounding word in English is "BROWN".</b></div>
<div>
<b>The closest sounding word in German is probably "BRAUN".</b></div>
<div>
<br /></div>
<div>
Here is a <a href="http://www.forvo.com/word/nicolaas_govert_de_bruijn/" target="_blank">recording</a> of his whole name being pronounced in Dutch. </div>
<div>
If you want to add some authenticity, try and roll the "R" a little bit.</div>
<div>
<br /></div>
<div>
Hopefully this puts an end to the confusion once and for all.</div>
<div>
<br /></div>
<div>
<br /></div>
<div>
(*) "Euler" is another <a href="https://en.wikipedia.org/wiki/Leonhard_Euler" target="_blank">German mathematician</a> whose name is often mispronounced in English. Most people say "yool-er" but it should be "oiler" (<a href="https://upload.wikimedia.org/wikipedia/commons/2/2a/De-Leonard_Euler.ogg" target="_blank">audio file</a>). So assembly software takes an "Oil-air-e-an Path through a de Brown graph" :-)</div>
<div>
<br /></div>
<div>
<br /></div>
<div>
<br /></div>
Torsten Seemannhttp://www.blogger.com/profile/12241185247897084810noreply@blogger.com9tag:blogger.com,1999:blog-1071661434473559589.post-17677252171765870402013-06-25T09:10:00.000+10:002013-06-25T09:11:58.677+10:00Extending a Windows XP partition in VirtualBox<h3>
<span style="font-family: Helvetica Neue, Arial, Helvetica, sans-serif;">The Problem</span></h3>
<div style="text-align: justify;">
<span style="font-family: Helvetica Neue, Arial, Helvetica, sans-serif;">My desktop computer runs Ubuntu Linux (on a Mac Mini!), but sometimes I am forced to use Microsoft Word to edit a document that LibreOffice/OpenOffice Writer can't handle, or use iTunes (<a href="http://www.techhive.com/article/149297/hate_itunes.html" target="_blank">ech</a>.) to fix the kids' iPad. To do this I use the excellent <a href="https://www.virtualbox.org/" target="_blank">VirtualBox</a> software to run an Windows XP virtual machine within Ubuntu. I originally created a 10GB virtual disk image, but soon realised that wasn't enough space if I wanted to also backup the 64GB iPad completely. Fortunately, VDI disk images can be increased in size, but my Googling resulted in a variety of methods which were all a bit confusing, so this post summarises what I had to do for my <i>exact</i> situation, which I didn't come across anywhere else.</span></div>
<span style="font-family: Helvetica Neue, Arial, Helvetica, sans-serif;"><br /></span>
<br />
<h3>
<span style="font-family: Helvetica Neue, Arial, Helvetica, sans-serif;">My Situtation</span></h3>
<ul>
<li><span style="font-family: Helvetica Neue, Arial, Helvetica, sans-serif;">Aim: <i>Grow my disk image storage from 10GB to 80GB</i></span></li>
<li><span style="font-family: Helvetica Neue, Arial, Helvetica, sans-serif;">Partition type: <i>NTFS</i></span></li>
<li><span style="font-family: Helvetica Neue, Arial, Helvetica, sans-serif;">Host operating system: <i>Ubuntu 13.04</i></span></li>
<li><span style="font-family: Helvetica Neue, Arial, Helvetica, sans-serif;">Virtual operating system: <i>Windows XP SP3</i></span></li>
</ul>
<br />
<h3>
<span style="font-family: Helvetica Neue, Arial, Helvetica, sans-serif;">How to do it</span></h3>
<br />
<ol>
<li><span style="font-family: Helvetica Neue, Arial, Helvetica, sans-serif;"><b>Locate the disk image: </b>On Ubuntu, VirtualBox stores your machine data in "</span><span style="font-family: Courier New, Courier, monospace;">$HOME/VirtualBox VMs</span><span style="font-family: Helvetica Neue, Arial, Helvetica, sans-serif;">" by default. In there find the appropriate .VDI file. Mine was called "</span><span style="font-family: Courier New, Courier, monospace;">WinXP.vdi</span><span style="font-family: Helvetica Neue, Arial, Helvetica, sans-serif;">".</span></li>
<li><b style="font-family: 'Helvetica Neue', Arial, Helvetica, sans-serif;">Expand the VDI image: </b><br /><span style="font-family: Helvetica Neue, Arial, Helvetica, sans-serif;">On Ubuntu you use the "</span><span style="font-family: Courier New, Courier, monospace;">VBoxManage</span><span style="font-family: Helvetica Neue, Arial, Helvetica, sans-serif;">" command to do this. You do </span><i style="font-family: 'Helvetica Neue', Arial, Helvetica, sans-serif;">not</i><span style="font-family: Helvetica Neue, Arial, Helvetica, sans-serif;"> need to "</span><span style="font-family: Courier New, Courier, monospace;">sudo</span><span style="font-family: Helvetica Neue, Arial, Helvetica, sans-serif;">" or be root as the files are all owned by you. This is the command I used to increase it to ~80GB:</span><br /><span style="font-family: Courier New, Courier, monospace;">VBoxManage modifyhd "$HOME/VirtualBox VMs/WinXP.vdi" 81920</span></li>
<li><span style="font-family: Helvetica Neue, Arial, Helvetica, sans-serif;"><b>Extend the NTFS partition: </b>Although you've extended the physical disk image, Windows XP still only thinks it has 10GB because the original partition on the disk was 10GB. We need to <i>extend</i> the NTFS partition into the new space we made. Because I only have one partition which has the operating system and all my data, you can't do this from within Windows XP itself. You need to boot something else to modify the partition. I downloaded the free <a href="http://gparted.sourceforge.net/livecd.php" target="_blank">GParted Live CD</a> ISO image and attached it to my virtual machine using the Settings and Storage menu on Virtual Box. I also made sure the virtual CD-ROM was in the boot order before the VDI image.<br />After starting the machine, the GParted interface eventually booted. I could see my 80GB disk with a 10GB NTFS partition on it. I chose the partition, and clicked "Resize" and typed in the full size of the disk (81920 MB). After clicking extend, it only took a few seconds to complete.</span></li>
<li><span style="font-family: Helvetica Neue, Arial, Helvetica, sans-serif;"><b>Reboot Windows:</b><br />I shut down the machine, removed the ISO image from the Storage menu, and restarted it. Windows XP started up "</span><span style="font-family: Courier New, Courier, monospace;">chkdsk</span><span style="font-family: Helvetica Neue, Arial, Helvetica, sans-serif;">" as it noticed something had changed :-) I had no errors or issues, and examination of drive C: showed it was now 80GB in size. Done!</span></li>
</ol>
<div>
<h3>
<span style="font-family: Helvetica Neue, Arial, Helvetica, sans-serif;">Conclusion</span></h3>
</div>
<div>
<span style="font-family: Helvetica Neue, Arial, Helvetica, sans-serif;">Virtual machines and virtual disk images are awesome. I'm glad to be finished with meddling with multi-boot and repartitioning real disks. I hope this post was helpful to you.</span></div>
<div>
<br /></div>
Torsten Seemannhttp://www.blogger.com/profile/12241185247897084810noreply@blogger.com5tag:blogger.com,1999:blog-1071661434473559589.post-29272072506104638712013-03-30T15:36:00.000+11:002013-03-30T15:36:27.575+11:00Bacterial genome annotation systems<h2>
Introduction</h2>
<div style="text-align: justify;">
You get a bacterial isolate. You sequence it. You manage to get some contigs after mucking around with some <i>de novo</i> assembly software. Now what? Annotation of course! Your FASTA file is teeming with lifeless chunks of bacterial DNA yearning to be adorned with insightfully labelled features, so it can get some more attention from you, and maybe even be reunited with some old friends in Genbank/ENA. If this sounds familiar, then this blog post is for you.</div>
<br />
<h2>
What is genome annotation?</h2>
<div style="text-align: justify;">
Genome annotation is the process of identifying features of interest on a genome sequence. Some of the features relevant to bacterial genomes are protein coding genes, non-coding RNAs, and operons. Features can have all sorts of useful information associated with them in addition to their genomic location and feature type. For example, a protein-coding gene annotation could include items such as the predicted protein product, whether it has a <a href="http://en.wikipedia.org/wiki/Signal_peptide" target="_blank">signal peptide</a>, a gene abbreviation and an <a href="http://en.wikipedia.org/wiki/EC-No" target="_blank">enzyme classification number</a>. The accuracy and richness of a genome annotation is important, and sometimes critical, to downstream biological interpretation.<br />
<br />
In the old days, a basic <a href="http://en.wikipedia.org/wiki/Open_reading_frame">ORF</a> finder would be run over the contigs. Then the truly dedicated curators would comb over the ORFs, trim back to good looking start codon sites, delete spurious looking ORFs, and so on. Later gene predictor software and BLASTX helped bootstrap this process further. Now there are various "automatic annotation" systems which do a reasonably good job. Manual refinement of the automatic annotation can then be done using curation applications.<br />
<br />
Below I list the tools I am aware of for performing and curating bacterial genome annotation. <i>If I've missed any please <a href="mailto:torsten.seemann@monash.edu?subject=Bacterial%20annotation%20blog%20post" target="_blank">let me know</a> and I will add them.</i><br />
<br /></div>
<h2 style="text-align: justify;">
Web submission systems</h2>
<div>
<ul>
<li><a href="http://rast.nmpdr.org/" target="_blank">RAST - Rapid Annotation using Subsystem Technology</a></li>
<li><a href="http://basys.ca/" target="_blank">BaSYS - Bacterial Annotation System</a></li>
<li><a href="http://www.xbase.ac.uk/annotation/" target="_blank">xBASE Bacterial Genome Annotation Service</a></li>
<li><a href="http://www.jcvi.org/cms/index.php?id=141" target="_blank">JVCI Annotation Service</a></li>
<li><a href="http://ae.igs.umaryland.edu/cgi/index.cgi" target="_blank">IGS Annotation Engine</a></li>
<li><a href="http://img.jgi.doe.gov/" target="_blank">JGI/DOE IMG annotation service</a></li>
<li><a href="http://www.ncbi.nlm.nih.gov/genomes/static/Pipeline.html" target="_blank">PGAAP - NCBI Prokaryotic Genome Automatic Annotation Pipeline</a></li>
<li><a href="http://derringer.genetics.utah.edu/cgi-bin/MWAS/maker.cgi" target="_blank">MAKER Web Annotation Service</a></li>
<li>Prokka Web Annotation Server <i>(disclaimer - this is our software - will be public soon)</i></li>
</ul>
<br />
<h2>
Standalone systems</h2>
<div>
<div>
<ul>
<li><a href="http://bg7.ohnosequences.com/" target="_blank">BG7 bacterial genome annotation system</a></li>
<li><a href="http://bhsai.org/software/" target="_blank">AGeS - Annotation/Analysis of Genome Sequences</a></li>
<li><a href="http://www.yandell-lab.org/software/maker.html" target="_blank">MAKER</a></li>
<li><a href="http://www.vicbioinformatics.com/software.prokka.shtml" target="_blank">Prokka - prokaryotic annotation</a> <i>(disclaimer - this is our software)</i></li>
</ul>
</div>
</div>
<br />
<h2 style="text-align: justify;">
Curation systems</h2>
<div>
<div>
<ul>
<li><a href="http://manatee.sourceforge.net/" target="_blank">Manatee</a> (web interface + database backend)</li>
<li><a href="http://www.sanger.ac.uk/resources/software/artemis/" target="_blank">Artemis</a> (local app, can be combined with Chado SQL backend)</li>
<li><a href="http://apollo.berkeleybop.org/current/index.html" target="_blank">Apollo</a> (local app, can be combined with Chado SQL backend)</li>
<li>Wasabi <i>(my old non-public awful CGI/Perl/make mess that we still use internally)</i></li>
</ul>
</div>
</div>
<br />
<h2>
Conclusion</h2>
<div style="text-align: justify;">
Beware of systems claiming to do "microbial" annotation. Most of them are only designed for annotating bacteria. They will perform poorly on viruses, fungi and other <a href="http://en.wikipedia.org/wiki/Microorganism" target="_blank">microbes</a>.</div>
<br />
<br />
<br />
<div>
<br /></div>
</div>
Torsten Seemannhttp://www.blogger.com/profile/12241185247897084810noreply@blogger.com18tag:blogger.com,1999:blog-1071661434473559589.post-72590641668023274582012-11-21T16:24:00.001+11:002013-06-20T09:26:57.885+10:00Cleaning Illumina FASTQ reads with Nesoni clip: <h3>
Introduction</h3>
<div style="text-align: justify;">
Cleaning <a href="http://en.wikipedia.org/wiki/FASTQ_format" target="_blank">FASTQ</a> reads is the process of removing those bits of the reads that you don't deem good enough to be given to the next stage of your pipeline. At worst, this could mean removing the whole read, and if the reads were paired, this means some reads will become "orphan" single reads. The cleaning process is often called filtering, trimming, clipping, or pruning. A FASTQ read has three parts: a sequence of bases, and a quality score for each base, and a sequence ID. The cleaning process only has access to this information.<br />
<br />
<h4>
Sequence</h4>
</div>
<div>
<div style="text-align: justify;">
<span style="text-align: justify;">In terms of the sequence itself, we may want to discard sequences which contain
<a href="http://en.wikipedia.org/wiki/Nucleic_acid_notation#IUPAC_notation" target="_blank">ambiguous DNA</a> symbols, most commonly "N" which means the base could not be called. Generally, reads with anything other than A,T,G,C are going to cause problems with most downstream analysis tools.</span></div>
<div style="text-align: justify;">
<span style="text-align: justify;"><br /></span></div>
<div style="text-align: justify;">
<span style="text-align: justify;">Preparing DNA for sequencing almost always involves ligating "adaptor" sequences to all the fragments of DNA. When things don't go perfectly, these <a href="http://seqanswers.com/forums/showthread.php?t=198" target="_blank">adaptors</a> can end up being sequenced, and be partially present at the start/end of your reads! This can </span><a href="http://en.wiktionary.org/wiki/wreak_havoc" target="_blank">wreak havoc</a> with downstream analyses like read alignment and <i>de novo </i>assembly. This mainly seems to occur with Illumina reads, especially mate-pair libraries and some RNA-Seq protocols. You should always check and remove these adaptor sequences.</div>
</div>
<br />
<h4>
Quality</h4>
<div style="text-align: justify;">
Usually when we think of cleaning FASTQ reads, we mean trimming on quality. Each base in a FASTQ read gets a <a href="http://en.wikipedia.org/wiki/Phred_quality_score" target="_blank">Phred quality score</a> which is an integer between 0 and 93 (as encoded in the Sanger FASTQ format) although you rarely see more than "Q45" or so. Low numbers are bad, high numbers are good. The numbers are on a logarithmic scale, and represent the probability of this base <b>not</b><i> </i>being correct. For example, a base of Q30 is expected to be wrong about 1 in 1000 times, or we are 99.9% confident in it. This means that in the millions of Q30 bases throughout all your reads, <i>thousands</i> of them are expected to be wrong! When we get down to Q10, one in ten bases are <a href="http://en.wiktionary.org/wiki/dodgy" target="_blank">dodgy</a>. Like any analysis, the "<a href="http://en.wiktionary.org/wiki/garbage_in,_garbage_out" target="_blank">garbage in, garbage out</a>" rule applies, and hence removing low quality reads is often a good strategy, especially if you don't know how well the downstream tool handles errors.<br />
<br />
In Illumina reads the quality tends to get <a href="http://en.wiktionary.org/wiki/monotonic_decreasing" target="_blank">monotonically</a> worse at the 3' end of the reads. Simply removing bases below a quality threshold T from the end is a common form of quality trimming. Alternatively you could average quality across a small window (3 bases say) and threshold that. Taking that idea to the limit, you could simply remove whole reads with average quality < T. There are many variations on this theme, and later I will discuss the approach we take.<br />
<br /></div>
<div>
<h4>
ID</h4>
<div>
<div style="text-align: justify;">
You probably think I'm crazy suggesting we can use the sequence ID to filter reads, right? In general, of course it does not make sense, however Illumina reads do contain some information in their read IDs. The most relevant are the series of colon-separated integers which some encode the<i> coordinates of the cluster on the flowcell lane which generated this sequence</i>. When we got the original Illumina Genome Analyzer (version 1!) it was clearly producing bad reads that came from the <i>edges</i> of the flowcell, due to poorer optical performance and other physical affects. You can still see this effect today when you open a FASTQ file, whereby lots of the reads at the start of the file are full of "N"s and have low quality - these come from the first tile in the corner of the flowcell lane. I'm not advocating using this information in reality, but it is interesting to keep in mind, and may actually be useful to someone if you were given a FASTA file where the quality information had been stripped away.</div>
</div>
<div>
<br /></div>
</div>
<div>
<h3>
What is Nesoni?</h3>
</div>
<div style="text-align: justify;">
<a href="http://www.vicbioinformatics.com/software.nesoni.shtml" target="_blank">Nesoni</a> (<a href="https://github.com/Victorian-Bioinformatics-Consortium/nesoni" target="_blank">github</a>) is our <a href="http://en.wikipedia.org/wiki/Swiss_Army_knife" target="_blank">Swiss Army knife</a> of NGS related tools, implemented primarily by <a href="http://www.logarithmic.net/pfh/" target="_blank">Paul Harrison</a> in our <a href="http://www.vicbioinformatics.com/staff.shtml" target="_blank">group</a>. It began as a wrapper for aligning reads and calling SNPs for the 100s of bacterial genome samples we were processing, but has now evolved into an extendible, distributable pipeline system which we hope to publish soon and actually document. I'll save the full description of Nesoni for another day, and today just focus on one of the simplest but still very useful tools it has.</div>
<br />
<h3>
The Nesoni clip: tool</h3>
If you just type "nesoni clip:" you will get this descriptive help information:<br />
<br />
<span style="font-family: 'Courier New', Courier, monospace; font-size: x-small;"> --adaptor-clip yes</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"> # Do adaptor clipping?</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"> --adaptor-file ...</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"> # FASTA file to read adaptors from. </span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"> # Defaults to a built-in list of</span><span style="font-family: 'Courier New', Courier, monospace; font-size: x-small;"> Illumina adaptors.</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"> --match 10</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"> # Minimum length adaptor match.</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"> --max-errors 1</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"> # Maximum errors in adaptor match. </span><span style="font-family: 'Courier New', Courier, monospace; font-size: x-small;">Note: slow for N > 1</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"> --clip-ambiguous yes</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"> # Clip ambiguous bases, eg N</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"> --quality 10</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"> # Quality cutoff</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"> --qoffset NNN</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"> # Quality character offset:</span><span style="font-family: 'Courier New', Courier, monospace; font-size: x-small;"> sanger: 33, solexa: 59, illumina: 64</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"> # Will guess if not given.</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"> --length 24</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"> # Reads shorter than this will be discarded.</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"> --homopolymers no</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"> # Set to yes to *remove* reads containing all the same base.</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"> --trim-to NNN</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"> # Trim ends of reads so that they are no longer than NNN bases,</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"> # irrespective of quality.</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"> --trim-start 0</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"> # Trim NNN bases from start of each read irrespective of quality.</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"> --trim-end 0</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"> # Trim NNN bases from end of each read irrespective of quality.</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"> --revcom no</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"> # Reverse complement all reads.</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"> # ie convert opp-out pairs to opp-in</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"> --fasta no</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"> # Output in fasta rather than fastq format.</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"> --gzip yes</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"> # Gzip output.</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"> --rejects no</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"> # Output rejected reads in separate file.</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"> --out-separate no</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"> # Output paired reads in separate left/right files.</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"><b> <prefix></b></span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"><b> # Prefix for output files.</b></span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"><i> reads: ...</i></span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"><i> # Files containing unpaired reads.</i></span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"><i> interleaved: ...</i></span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"><i> # Files containing interleaved read pairs.</i></span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"><i> pairs: ...</i></span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"><i> # Pair of files containing read pairs.</i></span><br />
<div>
<br /></div>
<div>
<div style="text-align: justify;">
It contains three main sections:<br />
<br />
<ol>
<li>The first is the standard getoptlong "--option" style options. </li>
<li>The <b>second</b> is the mandatory prefix for the the output files. </li>
<li>The <i>third</i> is the specification of all the input reads.</li>
</ol>
</div>
</div>
<br />
<h3>
Usage</h3>
<div>
<h4>
<span style="font-weight: normal;">The standard Illumina paired-end run gives you two files for the left and right reads:</span></h4>
<div>
<span style="font-family: 'Courier New', Courier, monospace; font-size: x-small;">Sample_R1.fastq.gz </span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;">Sample_R2.fastq.gz</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"><br /></span>
By default, Nesoni will quality clip at Q10, minimum length 24, and <u>will remove all known Illumina adaptors from TruSeq amd Nextera:</u><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"><br /></span>
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;">nesoni clip: clipped pairs: </span><span style="font-family: 'Courier New', Courier, monospace; font-size: x-small;">Sample_R1.fastq.gz </span><span style="font-family: 'Courier New', Courier, monospace; font-size: x-small;">Sample_R2.fastq.gz</span><br />
<span style="font-family: 'Courier New', Courier, monospace; font-size: x-small;"><br /></span>
The "clipped" is the output file prefix which is mandatory. The "pairs:" clause tells it that you are feeding it separate left and right files. It can optionally take interleaved pairs with the "interleaved:" clause. By default, the output is three files - the clean pairs (interleaved), any orphan reads, and an extensive log file which explains how many reads failed the various filters (adaptors, quality, length)<br />
<br />
<span style="font-family: 'Courier New', Courier, monospace; font-size: x-small;">clipped_paired.fq.gz</span><br />
<span style="font-family: 'Courier New', Courier, monospace; font-size: x-small;">clipped_single.fq.gz</span><br />
<span style="font-family: 'Courier New', Courier, monospace; font-size: x-small;">clipped_log.txt</span></div>
</div>
<div>
<br /></div>
<div>
You probably want your output as separate left/right files, and uncompressed, as to be compatible with most other software. Nesoni can do this with two extra options:<br />
<div>
<br /></div>
</div>
<div>
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;">nesoni clip: clipped \</span><br />
<span style="font-family: 'Courier New', Courier, monospace; font-size: x-small;"> --out-separate yes \</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"> --gzip no \</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"> pairs: </span><span style="font-family: 'Courier New', Courier, monospace; font-size: x-small;">Sample_R1.fastq.gz </span><span style="font-family: 'Courier New', Courier, monospace; font-size: x-small;">Sample_R2.fastq.gz</span><br />
<br />
This gives four files:<br />
<br />
<span style="font-family: 'Courier New', Courier, monospace; font-size: x-small;">clipped_R1.fq</span><br />
<span style="font-family: 'Courier New', Courier, monospace; font-size: x-small;">clipped_R2.fq</span><br />
<span style="font-family: 'Courier New', Courier, monospace; font-size: x-small;">clipped_single.fq</span><br />
<span style="font-family: 'Courier New', Courier, monospace; font-size: x-small;">clipped_log.txt</span></div>
<br />
<i> </i>Imagine you had five libraries, some FASTQ, some FASTA, some GZIP, some not:<br />
<br />
<span style="font-family: 'Courier New', Courier, monospace; font-size: x-small;">A_R1.fastq.gz <i>and</i> </span><span style="font-family: 'Courier New', Courier, monospace; font-size: x-small;">A_R2.fastq.gz</span><br />
<div>
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;">B_R1.fq <i>and</i> </span><span style="font-family: 'Courier New', Courier, monospace; font-size: x-small;">B_R2.fq</span></div>
<div>
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;">C_interleaved.fasta</span></div>
<div>
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;">D_single.fa</span></div>
<div>
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;">E_proton.fq.gz</span></div>
<br />
You can clip a whole bunch of mixed FASTQ files all in one command too. Just add more <i>input file clauses </i>like this:<br />
<i><br /></i>
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;">nesoni clip: clipped \</span><br />
<span style="font-family: 'Courier New', Courier, monospace; font-size: x-small;"> --out-separate yes \</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"> --gzip no \</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"> --length 50 \</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"> pairs: A</span><span style="font-family: 'Courier New', Courier, monospace; font-size: x-small;">_R1.fastq.gz A</span><span style="font-family: 'Courier New', Courier, monospace; font-size: x-small;">_R2.fastq.gz \</span><br />
<div>
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"> pairs: B</span><span style="font-family: 'Courier New', Courier, monospace; font-size: x-small;">_R1.fq B</span><span style="font-family: 'Courier New', Courier, monospace; font-size: x-small;">_R2.fq \</span></div>
<div>
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"> interleaved: C</span><span style="font-family: 'Courier New', Courier, monospace; font-size: x-small;">_interleaved</span><span style="font-family: 'Courier New', Courier, monospace; font-size: x-small;">.fasta \</span></div>
<div>
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"> reads: </span><span style="font-family: 'Courier New', Courier, monospace; font-size: x-small;">D_single.fa \</span><br />
<div>
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"> reads: E_proton.fq.gz </span></div>
<br /></div>
<div>
This will process all the input files, and give a clean result combined into just four files:<br />
<br />
<span style="font-family: 'Courier New', Courier, monospace; font-size: x-small;">clipped_R1.fq</span><br />
<span style="font-family: 'Courier New', Courier, monospace; font-size: x-small;">clipped_R2.fq</span><br />
<span style="font-family: 'Courier New', Courier, monospace; font-size: x-small;">clipped_single.fq</span><br />
<span style="font-family: 'Courier New', Courier, monospace; font-size: x-small;">clipped_log.txt</span></div>
<div>
<span style="font-family: 'Courier New', Courier, monospace; font-size: x-small;"><br /></span></div>
Pretty neat. As a general first pass for 2 x 150bp HiSeq(RapidRun) or 2 x 250bp MiSeq I use the following options:<br />
<br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;">nesoni clip: clipped --length 100 --quality 20</span><span style="font-family: 'Courier New', Courier, monospace; font-size: x-small;"> --out-separate yes </span><span style="font-family: 'Courier New', Courier, monospace; font-size: x-small;">--gzip no </span><br />
<br />
I hope this gave you a flavour of the flexibility of Nesoni's clip: module!<br />
<h3>
</h3>
<h3>
Conclusions</h3>
<div>
<br /></div>
<h4>
Advantages</h4>
<div>
<ul>
<li>Tries to keep as much of every read as possible</li>
<li>Maintains proper left/right ordering in paired read output</li>
<li>Can output interleaved or separate left/right</li>
<li>Outputs orphan singletons and rejected reads</li>
<li>Supports gzip compression for input and output</li>
<li>Can feed it all your read files at once - multiple pair sets, singles, interleaved</li>
<li>Automatic detection of quality encoding (Sanger 33, Illumina 64, Solexa 59)</li>
<li>Extensive reporting on Illumina adaptors for "forensic" work</li>
</ul>
</div>
<h4>
Disadvantages</h4>
<div>
<ul>
<li>Not a single clean binary or script, need whole Nesoni package</li>
<li>Slower than a native compiled implementation would be</li>
<li>Not packaged as a .deb or .rpm for BioLinux </li>
<li>Not in the Galaxy Toolshed</li>
</ul>
</div>
<h3>
<ul style="-webkit-text-stroke-width: 0px; color: black; font-family: 'Times New Roman'; font-size: medium; font-style: normal; font-variant: normal; font-weight: normal; letter-spacing: normal; line-height: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px;"></ul>
</h3>
<h3 style="-webkit-text-stroke-width: 0px; color: black; font-family: 'Times New Roman'; font-style: normal; font-variant: normal; letter-spacing: normal; line-height: normal; orphans: auto; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: auto; word-spacing: 0px;">
Download</h3>
<h3>
<ul>
<li><a href="http://www.vicbioinformatics.com/software.nesoni.shtml"><span style="font-size: small;">http://www.vicbioinformatics.com/software.nesoni.shtml</span></a></li>
</ul>
</h3>
<h3>
Related software</h3>
<ul>
<li><a href="http://www.usadellab.org/cms/index.php?page=trimmomatic" target="_blank">trimmomatic</a></li>
<li><a href="https://code.google.com/p/cutadapt/" target="_blank">cutadapt</a></li>
<li><a href="http://hannonlab.cshl.edu/fastx_toolkit/" target="_blank">fastx_toolkit</a></li>
</ul>
Torsten Seemannhttp://www.blogger.com/profile/12241185247897084810noreply@blogger.com6tag:blogger.com,1999:blog-1071661434473559589.post-53594477969912276762012-11-11T20:35:00.000+11:002014-07-24T05:22:03.437+10:00Tools to merge overlapping paired-end reads<h2>
Introduction</h2>
<div style="text-align: justify;">
In very simple terms, current sequencing technology begins by breaking up long pieces of DNA into lots more short pieces of DNA. The resultant set of DNA is called a "library" and the short pieces are called "fragments". Each of the fragments in the library are then sequenced individually and in parallel. There are two ways of sequencing a fragment - either just from one end, or from both ends of a fragment. If only one end is sequenced, you get a single read. If your technology can sequence both ends, you get a "pair" of reads for each fragment. These "paired-end" reads are standard practice on Illumina instruments like the GAIIx, HiSeq and MiSeq.</div>
<div style="text-align: justify;">
<br /></div>
<div style="text-align: justify;">
Now, for single-end reads, you need to make sure your read length (L) is shorter than your fragment length (F) or otherwise the sequence will run out of DNA to read! Typical Illumina fragment libraries would use F ~ 450bp but this is variable. For paired-end reads, you want to make sure that F is long enough to fit <i>two</i> reads. This means you need F to be at least 2L. As L=100 or 150bp these days for most people, using F~450bp is fine, there is a still a safety margin in the middle.</div>
<div style="text-align: justify;">
<br /></div>
<div style="text-align: justify;">
However, some things have changed in the Illumina ecosystem this year. Firstly, read lengths are now moving to >150bp on the HiSeq (and have already been on the GAIIx), and to >250bp on the MiSeq, with possibilities of longer ones coming soon! This means that the standard library size F~450bp has become too small, and <i>paired end reads will overlap</i>. Secondly, the new enyzmatic Nextera library preparation system produces a wide spread of F sizes compared to the previous TruSeq system. With Nextera, we see F ranging from 100bp to 900bp in the same library. So some reads will overlap, and others won't. It's starting to get messy.</div>
<div style="text-align: justify;">
<br /></div>
<div style="text-align: justify;">
The whole point of paired-end reads is to get the benefit of longer reads without actually being able to sequence reads that long. A paired-end read (two reads of length L) from a fragment of length F, is a bit like a single-read of length F, except a bunch of bases in the middle of it are unknown, and how many of them there are is only roughly known (as libraries are only nominally of length F, each read will vary). This gives the reads a longer context, and this particularly helps in <i>de novo</i> assembly and in aligning more reads unambiguously to a reference genome. However, many software tools will get confused if you give them overlapping pairs, and if we could overlap them and turn them into longer single-end reads, many tools will produce better results, and faster.</div>
<div style="text-align: justify;">
</div>
<div style="text-align: justify;">
<br /></div>
<br />
<h2>
The tools</h2>
<div style="text-align: justify;">
Here is a list of tools which can do the overlapping procedure. I am NOT going to review them all here. <span style="text-align: justify;">I've used one tool (FLASH) to overlap some MiSeq 2x150 PE reads, and then assembled them using Velvet, and the merged reads produced a "better" assembly than with the paired reads. But that's it. I write this post to inform people of the problem, and to collate all the tools in one place to save others effort. Enjoy!</span></div>
<br />
<br />
<ul>
<li><b>PEAR </b>(<i>Paired-End Read Merger)</i><br /><a href="http://sco.h-its.org/exelixis/web/software/pear/doc.html">http://sco.h-its.org/exelixis/web/software/pear/doc.html</a><b> <span style="font-family: inherit;"> </span></b><span style="color: #274e13; font-family: inherit;">(* this is what I use)</span></li>
<li><b>COPE</b> (<i>Connecting Overlapping Paired End reads</i>)<span style="background-color: white;"><span style="color: #555555; font-family: sans-serif; font-size: x-small;"><span style="line-height: 18px;"><br /></span></span></span><a href="http://sourceforge.net/projects/coperead/">http://sourceforge.net/projects/coperead/</a></li>
<li><b>SeqPrep</b><br /><a href="https://github.com/jstjohn/SeqPrep">https://github.com/jstjohn/SeqPrep</a></li>
<li><b>FLASH</b> (<i>Fast Length Adjustment of Short Reads to Improve Genome Assemblies</i>)<br /><a href="http://www.cbcb.umd.edu/software/flash">http://www.cbcb.umd.edu/software/flas</a>h</li>
<li><b>fastq-join</b> (part of ea-utils)<br /><a href="http://code.google.com/p/ea-utils/wiki/FastqJoin">http://code.google.com/p/ea-utils/wiki/FastqJoin</a></li>
<li><b>PANDAseq</b><br /><a href="https://github.com/neufeld/pandaseq">https://github.com/neufeld/pandaseq</a></li>
<li><b>stitch</b> (now defunct, merged into PANDAseq)<br /><a href="https://github.com/audy/stitch">https://github.com/audy/stitch</a></li>
<li><b>mergePairs.py</b><br /><a href="http://code.google.com/p/standardized-velvet-assembly-report/source/browse/trunk/mergePairs.py">http://code.google.com/p/standardized-velvet-assembly-report/source/browse/trunk/mergePairs.py</a></li>
</ul>
<br />
<h2>
Features to look for</h2>
<div>
<ul>
<li>Keeps original IDs in merged reads</li>
<li>Outputs the un-overlapped paired reads</li>
<li>Ability to strip adaptors first</li>
<li>Rescores the Phred qualities across the overlapped region</li>
<li>Parameters to control the overlap sensitivity</li>
<li>Handle .gz and .bz2 compressed files</li>
<li>Multi-threading support</li>
<li>Written in C/C++ (faster compiled) rather than Python/Perl (slower)</li>
</ul>
</div>
<div>
<br /></div>
Torsten Seemannhttp://www.blogger.com/profile/12241185247897084810noreply@blogger.com38tag:blogger.com,1999:blog-1071661434473559589.post-91018770379128886522012-11-06T16:39:00.001+11:002012-11-06T16:39:55.088+11:00Sorting FASTQ files by sequence length<br />
<h2>
<span style="font-family: inherit;">The problem</span></h2>
<div style="text-align: justify;">
<span style="font-family: inherit;"><br /></span></div>
<div style="text-align: justify;">
<span style="font-family: inherit;">The <a href="http://en.wikipedia.org/wiki/FASTQ_format" target="_blank">FASTQ file</a> format is used to store short sequence reads, most commonly those from Illumina. The reads are typically between 36 and 250 bp long, and typical data sets contain between 1M to 1B reads. Each entry in a FASTQ file contains three pieces of information: the sequence ID, the DNA sequence, and a quality string. I recently read through the documentation for the</span> <a href="https://khmer.readthedocs.org/en/latest/" target="_blank">khmer</a> package, and noticed a comment stating that <a href="http://ivory.idyll.org/blog/what-is-diginorm.html" target="_blank">digital normalisation</a> would work better if the FASTQ reads were in order from longest to shortest.<br />
<br />
I googled for some FASTQ sorting information. I found some posts on sorting by the sequence itself to remove duplicates (<a href="http://bridgecrest.blogspot.com.au/2011/08/sort-fastq-file-by-sequence.html" target="_blank">Justin's blog</a>), and some posts on sorting on ID to help with finding displaced pairs (<a href="http://www.biostars.org/p/47730/" target="_blank">BioStar</a>), but nothing on length sorting. There were some posts related to sorting FASTA files (<a href="http://wiki.bioinformatics.ucdavis.edu/index.php/Sort_sequence_in_fasta_format_by_their_length" target="_blank">Joe Fass</a>) but it read the whole file into RAM and didn't use a <a href="http://en.wikipedia.org/wiki/Schwartzian_transform" target="_blank">Schwartzian transform</a>.</div>
<div style="text-align: justify;">
<br /></div>
<h2>
Some solutions</h2>
Our first attempt was to use the <a href="http://thegenomefactory.blogspot.com.au/2012/05/cool-use-of-unix-paste-with-ngs.html" target="_blank">paste trick</a> I blogged about previously, where in.fq contains about 10M clipped reads with lengths between 24 and 100 bp:<br />
<span style="font-family: Courier New, Courier, monospace;"><br /></span>
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;">cat in.fq </span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;">| paste - - - - </span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;">| perl -ne '@x=split m/\t/; unshift @x, length($x[1]); print join "\t",@x;' </span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;">| sort -n </span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;">| cut -f2- </span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;">| tr "\t" "\n"</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;">> out.fq</span><br />
<div>
<br />
<div style="text-align: justify;">
This turns a 4-line FASTQ entry into a single tab separated line, adds a column with the length of each read, passes it to <a href="http://en.wikipedia.org/wiki/Sort_(Unix)" target="_blank">Unix sort</a>, removes the length column, and converts it back into a FASTQ file. And it works faster than I thought it would. About 2 minutes for a 10M read file. The whole process is I/O bound, so the faster your disks the better. The sort usually uses /tmp so if that is on a different disk unit ("spindle" for my more mature readers) to your input and/or output files, you'll get better performance. There are various chunk parameters etc you can change on sort, but it probably doesn't make too much difference.</div>
<br />
<div style="text-align: justify;">
Unix sort breaks the input into chunks, sorts each of those, then merges all the chunks in the output (<a href="http://en.wikipedia.org/wiki/Merge_sort" target="_blank">merge sort</a>). Another possibility which avoids explicit sorting is to read through the input, and put reads into separate files based on their read length (a simplistic <a href="http://en.wikipedia.org/wiki/Radix_sort" target="_blank">radix sort</a>). We can do this because we have a finite number of read lengths. The final output simply concatenates all the bin files in order. Here is an implementation in Perl, which is about 2x faster on average:</div>
<br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;">#!/usr/bin/env perl</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;">use strict;</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;">use warnings;</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;">use Fatal;</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;">use File::Temp qw(tempdir);</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"><br /></span>
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;">my $dir = tempdir(CLEANUP=>1);</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;">my @line;</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;">my @fh;</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"><br /></span>
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;">while ( ! eof () ) {</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"> $line[$_] = scalar(<>) for (0..3);</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"> my $len = length($line[1]) - 1;</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"> if ( not defined $fh[$len] ) {</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"> open $fh[$len], '>', "$dir/$len";</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"> }</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"> print {$fh[$len]} @line;</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;">}</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"><br /></span>
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;">for my $len (0 .. $#fh) {</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"> next unless defined $fh[$len];</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"> system("cat", "$dir/$len");</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;">}</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"><br /></span>
<h2>
Results</h2>
<div>
Here are some timing measurements across three files:</div>
<br />
<b><i>10 million reads</i></b><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;">Bash real 1m42.407s </span><span style="font-family: 'Courier New', Courier, monospace; font-size: x-small;">user</span><span style="font-size: x-small;"> </span><span style="font-family: 'Courier New', Courier, monospace; font-size: x-small;">1m57.863s </span><span style="font-family: 'Courier New', Courier, monospace; font-size: x-small;">sys</span><span class="Apple-tab-span" style="font-family: 'Courier New', Courier, monospace; font-size: x-small; white-space: pre;"> </span><span style="font-family: 'Courier New', Courier, monospace; font-size: x-small;">0m52.479s</span><br />
<span style="font-size: x-small;"><span style="font-family: Courier New, Courier, monospace;">Perl real 0m51.698s </span><span style="font-family: 'Courier New', Courier, monospace;">user</span> <span style="font-family: 'Courier New', Courier, monospace;">0m35.626s </span><span style="font-family: 'Courier New', Courier, monospace;">sys</span><span class="Apple-tab-span" style="font-family: 'Courier New', Courier, monospace; white-space: pre;"> </span><span style="font-family: 'Courier New', Courier, monospace;">0m9.897s</span></span><br />
<b><i>20 million reads</i></b><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;">Bash real 3m58.520s </span><span style="font-family: 'Courier New', Courier, monospace; font-size: x-small;">user</span><span style="font-size: x-small;"> </span><span style="font-family: 'Courier New', Courier, monospace; font-size: x-small;">4m2.155s </span><span style="font-family: 'Courier New', Courier, monospace; font-size: x-small;">sys</span><span class="Apple-tab-span" style="font-family: 'Courier New', Courier, monospace; font-size: x-small; white-space: pre;"> </span><span style="font-family: 'Courier New', Courier, monospace; font-size: x-small;">1m58.167s</span><br />
<span style="font-size: x-small;"><span style="font-family: 'Courier New', Courier, monospace;">Perl real</span> <span style="font-family: 'Courier New', Courier, monospace;">1m39.824s </span><span style="font-family: 'Courier New', Courier, monospace;">user</span><span class="Apple-tab-span" style="font-family: 'Courier New', Courier, monospace; white-space: pre;"> </span><span style="font-family: 'Courier New', Courier, monospace;">1m12.765s </span><span style="font-family: 'Courier New', Courier, monospace;">sys</span><span class="Apple-tab-span" style="font-family: 'Courier New', Courier, monospace; white-space: pre;"> </span><span style="font-family: 'Courier New', Courier, monospace;">0m20.409s</span></span><br />
<b><i>30 million reads</i></b><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;">Bash real 5m53.346s </span><span style="font-family: 'Courier New', Courier, monospace; font-size: x-small;">user</span><span style="font-size: x-small;"> </span><span style="font-family: 'Courier New', Courier, monospace; font-size: x-small;">6m16.736s </span><span style="font-family: 'Courier New', Courier, monospace; font-size: x-small;">sys</span><span class="Apple-tab-span" style="font-family: 'Courier New', Courier, monospace; font-size: x-small; white-space: pre;"> </span><span style="font-family: 'Courier New', Courier, monospace; font-size: x-small;">2m51.483s</span><br />
<span style="font-size: x-small;"><span style="font-family: 'Courier New', Courier, monospace;">Perl real</span> <span style="font-family: 'Courier New', Courier, monospace;">2m23.200s </span><span style="font-family: 'Courier New', Courier, monospace;">user</span><span class="Apple-tab-span" style="font-family: 'Courier New', Courier, monospace; white-space: pre;"> </span><span style="font-family: 'Courier New', Courier, monospace;">1m46.815s </span><span style="font-family: 'Courier New', Courier, monospace;">sys</span><span class="Apple-tab-span" style="font-family: 'Courier New', Courier, monospace; white-space: pre;"> </span><span style="font-family: 'Courier New', Courier, monospace;">0m30.754s</span></span><br />
<span style="font-size: x-small;"><span style="font-family: 'Courier New', Courier, monospace;"><br /></span></span>
On face value, it appears the shell version ("Bash") is behaving in an O(N.logN) fashion, whereas the Perl implementation seems to be O(N) linear, which is somewhat expected given it reads all the data, writes all the data, then writes it all again. More testing and thinking is needed.<br />
<br />
<h2>
Conclusion</h2>
<div>
<div style="text-align: justify;">
Sorting huge FASTQ files is feasible. If applications like diginorm become mainstream and sorting clipped FASTQ files make it work better, than this is handy to know. Nothing groundbreaking here, and I may have repeated other people's work, but I hope it is useful to somebody.</div>
</div>
<br />
<br />
<br />
<div>
<br /></div>
<div>
<br /></div>
<div>
<br /></div>
<div>
<br /></div>
<div>
<br /></div>
</div>
Torsten Seemannhttp://www.blogger.com/profile/12241185247897084810noreply@blogger.com7Melbourne VIC, Australia-37.8113667 144.9718286-38.6142332 143.7084011 -37.0085002 146.23525610000002tag:blogger.com,1999:blog-1071661434473559589.post-72925900524937001952012-10-20T10:08:00.000+11:002012-10-20T10:08:10.896+11:00The joy of academic conference spam<span style="background-color: white; color: #222222; font-size: 13px;"><span style="font-family: inherit;"><br /></span></span>
<span style="background-color: white; color: #222222; font-size: 13px;"><span style="font-family: inherit;">Once you get your names on a few papers, the influx of academic spam increases. I probably get at least two of these spams a day in my inbox (not counting the ones that are diverted by Google's spam filter). I suspect those academics higher up the chain get even more. The most common ones are requests for conference attendance, session chairing, and reviewing; closely followed by international students and graduates looking for jobs or Ph.D. placements. They are nearly always totally unrelated to what I work on (computational genomics).</span></span><br />
<span style="background-color: white; color: #222222; font-size: 13px;"><span style="font-family: inherit;"><br /></span></span>
<span style="background-color: white; color: #222222; font-size: 13px;"><span style="font-family: inherit;">I got a classic example today:</span></span><br />
<span style="font-family: Courier New, Courier, monospace;"><span style="background-color: white; color: #222222; font-size: 13px;"><br /></span></span>
<span style="font-family: Courier New, Courier, monospace;"><span style="background-color: white; color: #222222; font-size: 13px;">To: torsten.seemann@monash.spam.edu</span></span><br />
<span style="font-family: Courier New, Courier, monospace;"><span style="background-color: white; color: #222222; font-size: 13px;">Dear Torsten Seeman: </span></span><br />
<span style="font-family: Courier New, Courier, monospace;"><br /></span>
<i><b><span style="font-family: inherit;">Umm, you spelled my surname incorrectly. Sorry for misleading you with the correct spelling in my email address, websites, blog, and Twitter account.</span></b></i><br />
<span style="font-family: Courier New, Courier, monospace;"><br style="background-color: white; color: #222222; font-size: 13px;" /><span style="background-color: white; color: #222222; font-size: 13px;">The four sponsoring societies of DDW invite you to submit an abstract for presentation at DDW 2013 Scientific Sessions, to be held Saturday, May 18-Tuesday, May 21, 2013 in Orlando, FL. </span><span style="background-color: white; color: #222222; font-size: 13px;">The DDW 2013 online abstract submission site is now open and will close on Saturday, December 1, 2012 at 9 p.m. ET.</span><span style="background-color: white; color: #222222; font-size: 13px;"> </span></span><br />
<span style="font-family: Courier New, Courier, monospace;"><span style="background-color: white; color: #222222; font-size: 13px;"><br /></span></span>
<br />
<span style="font-family: inherit;"><i><b>So it's in "Orlando, FL". Because I am Australian, I do have some idea of what else is in the world, and can deduce it is in the USA. But you are ignorant if you think the whole of the world knows all your two-letter USPS state codes! eg. CA = California or Canada? And unlike you, I know Canada is a country and not just a French speaking state of the USA.</b></i></span><br />
<br />
<span style="font-family: Courier New, Courier, monospace;"><span style="background-color: white; color: #222222; font-size: 13px;"><br /></span></span>
<span style="font-family: Courier New, Courier, monospace;"><span style="color: #222222; font-size: x-small;"><i><snip></i></span><span style="background-color: white; color: #222222; font-size: 13px;">DDW 2013 Abstract Submission Site: </span><br style="background-color: white; color: #222222; font-size: 13px;" /><a href="http://ddw2013.abstractcentral.com/" style="background-color: white; color: #1155cc; font-size: 13px;" target="_blank">http://ddw2013.<wbr></wbr>abstractcentral.com</a><span style="background-color: white; color: #222222; font-size: 13px;"> </span><br /><span style="background-color: white; color: #222222; font-size: 13px;">Poster sessions and DDW programming will start on Saturday, May 18, 2013. If your abstract is accepted, it may be scheduled for presentation on Saturday, Sunday, Monday or Tuesday. </span><br style="background-color: white; color: #222222; font-size: 13px;" /><span style="background-color: white; color: #222222; font-size: 13px;">Sincerely,</span><span style="background-color: white; color: #222222; font-size: 13px;"> </span><br /><span style="background-color: white; color: #222222; font-size: 13px;">DDW Administration </span><br style="background-color: white; color: #222222; font-size: 13px;" /><a href="mailto:DDWprogram@gastro.org" style="background-color: white; color: #1155cc; font-size: 13px;" target="_blank">DDWprogram@gastro.org</a></span><br />
<br />
<br />
<span style="font-family: inherit;"><i><b>Hmm, you still haven't explained what the hell "DDW" is. Your email domain is giving me a hint, but that was the last line of the email. OK, I'll click on the link to find out - I can't help myself. </b></i></span><i style="font-family: inherit;"><b>"Digestive Disease Week" eh? </b></i><i style="font-family: inherit;"><b>Thanks for giving me the shits.</b></i><br />
<i style="font-family: inherit;"><b><br /></b></i>
<b><i>[Report Spam] clicked.</i></b><br />
<b><i><br /></i></b>
<b><i><br /></i></b>
<div>
<span style="font-family: inherit;"><i><b><br /></b></i></span></div>
Torsten Seemannhttp://www.blogger.com/profile/12241185247897084810noreply@blogger.com0tag:blogger.com,1999:blog-1071661434473559589.post-19764321538532149752012-10-08T08:56:00.000+11:002012-10-08T08:56:33.015+11:00Building a bioinformatics server on a budget in 2012<div>
<br /></div>
<h2>
Introduction</h2>
<div style="text-align: justify;">
As more labs get into the "next generation sequencing" game, they are finding themselves unwittingly entering into the "high performance computing" game too. Some lucky labs will be able to access a local or national HPC service, or collaborate with those who do, or pay for access to one like Amazon EC2. But ultimately any bioinformatician will want (and need) a "general server" to experiment, develop, and test on. This is particularly true in terms of large, fast storage which is usually in short supply or costly in HPC environments.</div>
<div style="text-align: justify;">
<br /></div>
<h2>
Details</h2>
<div style="text-align: justify;">
<br /></div>
<div style="text-align: justify;">
With the small lab in mind, here I outline how, for about A$2500/US$2600/<span class="selflink" style="background-color: #f9f9f9; font-family: sans-serif; font-size: 14px; line-height: 16.883333206176758px; text-align: right;">€</span>2000), you can build your own server with 6/12 cores, 64GB RAM, and 12TB RAID storage from affordable commodity parts:</div>
<div>
<br /></div>
<ul>
<li><b>CPU</b></li>
<ul>
<li><a href="http://www.centrecom.com.au/catalog/intel-core-3930k-2011-p-54680.html">Intel CORE i7 3930K - LGA 2011</a> </li>
<li>$580</li>
<li>The Intel CPUs are about 40% faster for the same clock rate than the equivalent AMD. This is a 3.2 Ghz 6 core CPU (12 threads) and can go to 3.8 Ghz when only using some of the cores. It has good RAM bandwidth too.<br /></li>
</ul>
<li><b>CPU Cooler</b></li>
<ul>
<li><a href="http://www.centrecom.com.au/catalog/cfan-clp0597-thermaltake-contac-p-57243.html" target="_blank">Thermaltake Contac 39</a></li>
<li>$49</li>
<li>The above CPU doesn't come with a stock cooler.<br /></li>
</ul>
<li><b>Motherboard</b></li>
<ul>
<li><a href="http://www.centrecom.com.au/catalog/gigabyte-intel-mainboard-2011-p-59881.html">Gigabyte GA-X79-UP4 Intel Mainboard - LGA 2011</a> </li>
<li>$269</li>
<li>This motherboard was chosen as it takes the new LGA2011 CPU, has 8 DIMM slots, and 8 SATA ports, including 6.0Gbsp SATA3 ones which we will want for the SSD boot disk described later. We will save money by using Linux software RAID.<br /></li>
</ul>
<li><b>RAM</b></li>
<ul>
<li><a href="http://www.centrecom.com.au/catalog/gskill-ddr3-32gb-4x8gb-128001600-ripjawsz-12800cl10q-32gbzl-p-58907.html">G.SKILL DDR3 32GB (4x8GB) PC-12800/1600 RipjawsZ F3-12800CL10Q-32GBZL</a> </li>
<li>$318 (2 kits)</li>
<li>Using 8 x 8GB DIMMs for 64GB total RAM. This is about the most you can affordably get on a consumer motherboard today.<br /></li>
</ul>
<li><b>Root disk</b></li>
<ul>
<li><a href="http://www.centrecom.com.au/catalog/agility-series-120gb-sata-6gbs-p-51783.html">OCZ Agility 3 Series 120GB 2.5" SSD Sata 6Gbs</a> </li>
<li>$170 (2 drives)</li>
<li>For the boot/root disk, we will use 120GB SSD instead of mechanical hard disk, for speed. Two disks in RAID1 (mirror) configuration. This would store the operating system, and any important databases eg. BLAST indices, SQL etc.<br /></li>
</ul>
<li><b>Data disk</b></li>
<ul>
<li><a href="http://www.centrecom.com.au/catalog/seagate-barracuda-p-55742.html">Seagate Barracuda 3TB</a> </li>
<li>$924 (6 drives)</li>
<li>In bioinformatics you can never have enough disk space! Here I suggest using six 3TB 7200rpm drives in RAID6 arrangement for a total of 12TB storage. Reading will be fast, but writing a bit slower. We need to compromise on a budget.</li>
</ul>
<li><b>Case</b></li>
<ul>
<li><a href="http://www.centrecom.com.au/catalog/antec-p280-p-55373.html">Antec P280 </a></li>
<li>$135</li>
<li>To hold all this stuff, this case is great value. It has good ventilation, which is crucial for keeping all the disks and the CPU cool.<br /></li>
</ul>
<li><b>Power supply</b></li>
<ul>
<li><a href="http://www.centrecom.com.au/catalog/antec-truepower-series-650w-p-36656.html">Antec TruePower New Series 650W</a> </li>
<li>$120</li>
<li>The case doesn't come with a power supply. I've chosen this one because it has 9 SATA power connectors for the disks, and some unneeded cable sets can be removed in a modular fashion.<br /></li>
</ul>
<li><b>Operating system</b></li>
<ul>
<li><a href="http://www.ubuntu.com/download/server" target="_blank">Ubuntu Server</a></li>
<li>$0</li>
<li>Ubuntu Server edition is pre-tuned for server settings as opposed to interactive desktop use. Because it is Debian based, you have access to far more packaged bioinformatics applications than Centos, including those in the <a href="http://nebc.nerc.ac.uk/tools/bio-linux/" target="_blank">BioLinux</a> project.<br /></li>
</ul>
<li><b>Miscellaneous</b></li>
<ul>
<li>Extra 120mm cooling fans (for the hard disk zones)</li>
<li>Extra SATA3 cables (ones with locking clips)</li>
<li>CPU thermal paste (the grey stuff)</li>
<li>PCIe graphics card (for the screen, any old one will do)</li>
</ul>
</ul>
<h2>
<br /></h2>
<h2>
Conclusion</h2>
<div>
<span style="text-align: justify;">For about A$2500/US$2600/</span><span class="selflink" style="background-color: #f9f9f9; font-family: sans-serif; font-size: 14px; line-height: 16.883333206176758px; text-align: right;">€</span><span style="text-align: justify;">2000 and a little bit of Linux know-how, you can build your own "high-end" server. It is missing some of the features of commercial servers from Dell etc (eg. hardware RAID controller, IPMI remote management, hot-swap disks) but it is much more affordable.</span></div>
<div>
<span style="text-align: justify;"><br /></span></div>
<div>
<span style="text-align: justify;"><br /></span></div>
Torsten Seemannhttp://www.blogger.com/profile/12241185247897084810noreply@blogger.com13tag:blogger.com,1999:blog-1071661434473559589.post-56192175150176861472012-09-21T11:51:00.001+10:002012-09-21T11:57:58.436+10:00Problematic FASTQ output from Ion TorrentSuite 3.0<span style="font-family: Arial, Helvetica, sans-serif;">Yesterday we got an email from a <a href="http://www.vicbioinformatics.com/software.nesoni.shtml" target="_blank">Nesoni</a> user who said that the <a href="http://compbio.cs.toronto.edu/shrimp/" target="_blank">SHRiMP</a> aligner was failing on his FASTQ data. Then again today we got another similar report from our trusted colleague <a href="http://www.microbiol.unimelb.edu.au/research/microbiology/stinear.html" target="_blank">Tim Stinear</a> with the same issue. The evidence was mounting for a bug either in Nesoni or in the FASTQ file, rather than <a href="http://en.wikipedia.org/wiki/User_error" target="_blank">user error</a>.</span>
<span style="font-family: Arial, Helvetica, sans-serif;">Tim had recently upgraded his PGM Sequencer to </span><a href="http://ir.lifetechnologies.com/releasedetail.cfm?ReleaseID=704985" style="font-family: Arial, Helvetica, sans-serif;" target="_blank">Torrent Suite v3.0</a><span style="font-family: Arial, Helvetica, sans-serif;"> (point zero release alarm bells!), and</span><span style="font-family: Arial, Helvetica, sans-serif;"> Nesoni saved the </span><i style="font-family: Arial, Helvetica, sans-serif;">shrimp_log.txt</i><span style="font-family: Arial, Helvetica, sans-serif;"> file and it contained this:</span><br />
<span style="font-family: Arial, Helvetica, sans-serif;"><br /></span>
<br />
<pre>note: quality value format set to PHRED+33
done r/hr r/core-hr
The qv-offset might be set incorrectly! Currenty qvs are interpreted as PHRED+33 and <b>a qv of 62 was observed</b>. To disable this error, etiher set the offset correctly or disable this check (see README).</pre>
<span style="font-family: Arial, Helvetica, sans-serif;"><br /></span>
<span style="font-family: Arial, Helvetica, sans-serif;">
</span>
<span style="font-family: Arial, Helvetica, sans-serif;">Wow! The PGM has improved dramatically, calling some bases at Q62, that's better than 1 in 1 million error rate... Here's a breakdown of the Q values in the file:</span>
<br />
<pre><span style="font-size: x-small;"><b>
</b></span></pre>
<pre><span style="font-size: x-small;"><b>Symbol ASCII Q+33 Frequency</b>
+ 43 10 1105774
, 44 11 347753
- 45 12 1167099
. 46 13 673276
/ 47 14 137220
0 48 15 225893
1 49 16 1621714
2 50 17 1731775
3 51 18 2726736
4 52 19 4280447
5 53 20 4272951
6 54 21 2556953
7 55 22 7783535
8 56 23 5153631
9 57 24 2362016
: 58 25 2406869
; 59 26 2517450
< 60 27 5762153
= 61 28 4334469
> 62 29 7109066
? 63 30 11113780
@ 64 31 13934507
A 65 32 9227417
B 66 33 12758868
C 67 34 8228985
D 68 35 9935410
E 69 36 1459950
F 70 37 2358692
G 71 38 682190
H 72 39 158322
I 73 40 168311
<span style="background-color: #fce5cd;">J 74 41 269
K 75 42 199121
L 76 43 83457
M 77 44 4971
N 78 45 464143
O 79 46 8657</span>
P 80 47 0
Q 81 48 0
R 82 49 0
S 83 50 0
T 84 51 0
U 85 52 0
V 86 53 0
W 87 54 0
X 88 55 0
Y 89 56 0
Z 90 57 0
[ 91 58 0
\ 92 59 0
] 93 60 0
^ 94 61 0
<span style="background-color: yellow;">_ 95 62 746</span></span>
</pre>
<pre><span style="background-color: yellow;">
</span></pre>
<pre></pre>
<pre><span style="font-family: Arial, Helvetica, sans-serif;">Ok, there really are 746 bases with Q62. Some <i>grep</i> work shows me they are all occuring alone in 746 reads, all in position 1 in the read, like this:</span></pre>
<pre><span style="font-family: Arial, Helvetica, sans-serif;">
</span></pre>
<pre><span style="font-family: Courier New, Courier, monospace;">@QWRK0:02580:02076
GGGAATCAAAACGCTGATTTTTGATGAACAGAATAACGAA
+
<span style="background-color: yellow;">_</span>8,59=<<@@6@BCCDDDFFF3FEEEFAEC@@;77-7777</span>
</pre>
<div>
<span style="font-family: Courier New, Courier, monospace;"><br /></span></div>
<div>
<pre><span style="font-family: Arial, Helvetica, sans-serif;">The table also shows quite a few >Q41 bases, which aren't typically seen in <a href="http://en.wikipedia.org/wiki/FASTQ_format" target="_blank">FASTQ</a> files. These ones are probably ok (?) but the Q62 ones surely must be some artifact or bug in the version 3.0 of Torrent Suite.</span></pre>
<pre><span style="font-family: Arial, Helvetica, sans-serif;">In the meantime, our solution has been this:</span></pre>
<pre><span style="font-family: Arial, Helvetica, sans-serif;">
</span></pre>
<pre><span style="font-family: Courier New, Courier, monospace;">sed 's/^_/H/' < dodgy.fastq > fixed.fastq</span></pre>
<pre><span style="font-family: Arial, Helvetica, sans-serif;">
</span></pre>
<pre><span style="font-family: Arial, Helvetica, sans-serif;">Be interested to see if others have encountered this problem.</span></pre>
</div>
<div>
<span style="font-family: Arial, Helvetica, sans-serif;"><br /></span></div>
<div>
<span style="font-family: Courier New, Courier, monospace;"><br /></span></div>
Torsten Seemannhttp://www.blogger.com/profile/12241185247897084810noreply@blogger.com2tag:blogger.com,1999:blog-1071661434473559589.post-78628211236111225732012-09-08T12:11:00.000+10:002012-09-08T15:48:54.314+10:00Using Velvet with mate-pair sequences<h2>
Introduction</h2>
Illumina sequencing instruments (HiSeq, MiSeq, Genome Analyzer) can produce three main types of reads when sequencing genomic DNA:<br />
<ol>
<li><b>Single-end</b><br />Each "read" is a single sequence from one end of a DNA fragment. The fragment is usually 200-800bp long, with the amount being read can be chosen between 50 and 250 bp.</li>
<li><b>Paired-end</b><br />Each "read" is two sequences (a pair) from each end of the same genomic DNA fragment <b>(</b><a href="http://www.illumina.com/technology/paired_end_sequencing_assay.ilmn" target="_blank">more info</a>). The distance between the reads on the original genome sequence is equal to the length of the DNA fragment that was sequenced (usually 200-800 bp).</li>
<li><b>Mate-pair:</b><br />Like paired-end reads, each "read" is two sequences from each end of the same DNA fragment, but the DNA fragment has been engineered from a circularization process (<a href="http://www.illumina.com/technology/mate_pair_sequencing_assay.ilmn" target="_blank">more info</a>) such that the distance between the reads on the original genome sequence is much longer (say 3000-10000 bp) than the proxy DNA fragment (200-800 bp).</li>
</ol>
<h2>
Single-end library ("SE")</h2>
<div style="text-align: justify;">
When we got the original Illumina Genome Analyzer, all it could do was 36 bp single-end reads, and each lane gave us a massive 250 Mbp, and we had to walk 7 miles through snow in the dark to get it. Ok, that last bit is clearly false as we don't get snow in Australia and we speak metric here, but the point is that there is still plenty of legacy SE data around, and SE reads are still used in RNA-Seq sometimes. Let's imagine our data was provided as a standard FASTQ file called <i>SE.fq</i>:</div>
<div style="text-align: justify;">
<br /></div>
<div style="text-align: justify;">
<span style="font-family: Courier New, Courier, monospace;">velveth Dir 31 <b>-short</b> -fastq <b>SE.fq</b></span></div>
<div style="text-align: justify;">
<span style="font-family: Courier New, Courier, monospace;">velvetg Dir -exp_cov auto -cov_cutoff auto</span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"><br /></span><span style="font-size: small;">I strongly recommend enabling the </span><i>-exp_cov auto </i><span style="font-size: small;">and </span><i>-cov_cutoff auto</i><span style="font-size: small;"> options. They will almost always improve the quality of your assemblies.</span><br />
<span style="font-size: small;"><br /></span></div>
<h2>
Paired-end library ("PE")</h2>
<div style="text-align: justify;">
Paired-end reads are the standard output of most Illumina sequencers these days, currently 2x100bp for the HiSeq and 2x150bp for the GAIIx and MiSeq, but they are all migrating to 2x250bp soon. The two sequences per paired read are typically distributed in two separate files, the "1" file contains all the "left" reads and the "2" file contains all the corresponding "right" reads. Let's imagine our paired-end run gave us two files in standard FASTQ format, <i>PE_1.fq</i> and <i>PE_2.fq</i>:</div>
<br />
<div style="text-align: justify;">
<span style="font-family: Courier New, Courier, monospace;">velveth Dir 31 <b>-shortPaired -separate</b> -fastq <b>PE_1.fq PE_2.fq</b></span></div>
<div style="text-align: justify;">
<span style="font-family: Courier New, Courier, monospace;">velvetg Dir -exp_cov auto -cov_cutoff auto</span></div>
<div>
<span style="font-family: Courier New, Courier, monospace;"><br /></span></div>
<div style="text-align: justify;">
Previously you had to interleaved the left and right files for Velvet, but we recently added support to Velvet for the <i>-separate</i> option which we hope is now saving time and disk space throughout the Velvetsphere!<br />
<br /></div>
<h2>
Mate-pair library ("MP")</h2>
<div style="text-align: justify;">
Mate-pair reads are extremely valuable in a <i>de novo</i> setting as they provide long-range information about the genome, and can help link contigs together into larger scaffolds. They have been used reliably for years on the 454 FLX platform, but used less often on the Illumina platform. I think the main reasons for this are the poorer reliability of the Illumina mate-pair protocol and the larger amount of DNA required compared to a PE library.</div>
<br />
<div style="text-align: justify;">
We can consider MP reads as the same as PE reads, but with a larger distance between them ("insert size"). But there is one technical difference due to the circularization procedure used in their preparation. PE reads are oriented "opp-in" (L=>.....<=R), whereas MP reads are oriented "opp-out" (L<=.....=>R). Velvet likes its paired reads to be in opp-in orientation, so we need to reverse-complement all our MP reads first, which I do here with the <a href="http://emboss.sourceforge.net/apps/release/6.3/emboss/apps/revseq.html" target="_blank">EMBOSS "revseq" tool</a>.</div>
<br />
<div style="text-align: justify;">
<span style="font-family: Courier New, Courier, monospace;">revseq -sequence MP_1.fq -outseq rcMP_1.fq -notag</span></div>
<div style="text-align: justify;">
<span style="font-family: Courier New, Courier, monospace;">revseq -sequence MP_2.fq -outseq rcMP_2.fq -notag</span></div>
<div style="text-align: justify;">
<span style="font-family: 'Courier New', Courier, monospace;">velveth Dir 31</span><span style="font-family: 'Courier New', Courier, monospace;"> </span><b style="font-family: 'Courier New', Courier, monospace;">-shortPaired -separate</b><span style="font-family: 'Courier New', Courier, monospace;"> </span><span style="font-family: 'Courier New', Courier, monospace;">-fastq</span><span style="font-family: 'Courier New', Courier, monospace;"> </span><b style="font-family: 'Courier New', Courier, monospace;">rcMP_1.fq rcMP_2.fq</b></div>
<div style="text-align: justify;">
<span style="font-family: Courier New, Courier, monospace;">velvetg Dir -exp_cov auto -cov_cutoff auto <b>-shortMatePaired yes</b></span><br />
<span style="font-family: Courier New, Courier, monospace; font-size: x-small;"><b><br /></b></span>
<br />
<div style="text-align: justify;">
Early Illumina MP libraries are often contaminated with PE reads (the so-called <a href="http://biodiv.tw/symposium/genomics/doc/Dr_Sylvain_FORET.pdf" target="_blank">shadow library</a>) which are the result of imperfect selection of biotin-marked fragments in the circularization process. There is a special option in <i>velvetg</i> (not <i>velveth</i>) called <i>-shortMatePaired</i> added by <a href="http://biology.anu.edu.au/sylvain_foret/" target="_blank">Sylvain Foret</a> which informs Velvet that a paired channel is MP but may contain PE reads, which helps it to account for them and avoid mis-scaffolding. I recommend using this no matter how pure you think your MP library is.<br />
<br /></div>
</div>
<h2>
Combining them all! (SE + PE + MP)</h2>
When <i>de novo</i> assembling multiple libraries in Velvet, you should order them from smallest insert size to largest insert size. For our case, this means the SE first, then the PE, then the MP. Each library must go in its own "channel" as it comes from a differently prepared DNA library. Channels are specified in Velvet with a numerical suffix on the read-type parameter (absence means channel 0):<br />
<br />
<div style="text-align: justify;">
<span style="font-family: Courier New, Courier, monospace;">velveth \</span></div>
<div style="text-align: justify;">
<span style="font-family: Courier New, Courier, monospace;"> Dir 31 \</span></div>
<div style="text-align: justify;">
<span style="font-family: Courier New, Courier, monospace;"><b> -short</b> -fastq <b>SE.fq \</b></span></div>
<div style="text-align: justify;">
<span style="font-family: 'Courier New', Courier, monospace;"> </span><b style="font-family: 'Courier New', Courier, monospace;">-shortPaired2 -separate</b><span style="font-family: 'Courier New', Courier, monospace;"> </span><span style="font-family: 'Courier New', Courier, monospace;">-fastq</span><span style="font-family: 'Courier New', Courier, monospace;"> </span><b style="font-family: 'Courier New', Courier, monospace;">PE_1.fq PE_2.fq \</b></div>
<div style="text-align: justify;">
<span style="font-family: 'Courier New', Courier, monospace;"> </span><b style="font-family: 'Courier New', Courier, monospace;">-shortPaired3 -separate</b><span style="font-family: 'Courier New', Courier, monospace;"> </span><span style="font-family: 'Courier New', Courier, monospace;">-fastq</span><span style="font-family: 'Courier New', Courier, monospace;"> </span><b style="font-family: 'Courier New', Courier, monospace;">rcMP_1.fq rcMP_2.fq </b></div>
<div style="text-align: justify;">
<b style="font-family: 'Courier New', Courier, monospace;"><br /></b></div>
<div>
<div style="text-align: justify;">
<span style="font-family: Courier New, Courier, monospace;">velvetg \</span></div>
<div style="text-align: justify;">
<span style="font-family: Courier New, Courier, monospace;"> Dir \</span></div>
<div style="text-align: justify;">
<span style="font-family: Courier New, Courier, monospace;"> -exp_cov auto -cov_cutoff auto \</span></div>
<div style="text-align: justify;">
<span style="font-family: Courier New, Courier, monospace;"><b> -shortMatePaired3 yes</b></span></div>
</div>
<br />
<div style="text-align: justify;">
Note that the <i>-shortMatePaired</i> option has been allocated to channel 3 now (the <i>-shortPaired3 </i>library) as that is the MP channel.<br />
<br /></div>
<h2>
Conclusions</h2>
<div>
It's relatively to get up and running with Velvet, but when your projects become more complicated, the methods in this post should help you. But if you prefer a nice GUI to take care of most of the issues discussed here, I recommend using our Velvet GUI called <a href="http://bioinformatics.net.au/software.vague.shtml" target="_blank">VAGUE</a> (Velvet Assembler Graphical User Environment). </div>
<br />
<br />
<br />Torsten Seemannhttp://www.blogger.com/profile/12241185247897084810noreply@blogger.com47tag:blogger.com,1999:blog-1071661434473559589.post-22995925690819932632012-07-24T13:55:00.000+10:002012-08-12T16:21:23.212+10:00Navigating microbial genomes on the NCBI FTP site<span style="font-family: inherit;">If you are a bioinformatician working in microbial genomics, then you should know this URL:<br /></span><br />
<div style="text-align: center;">
<div style="text-align: left;">
<a href="ftp://ftp.ncbi.nih.gov/genomes/"><span style="font-family: inherit;"><b>ftp://ftp.ncbi.nih.gov/genomes/</b></span></a></div>
</div>
<div style="text-align: center;">
<span style="font-family: inherit;"><br /></span></div>
<div style="text-align: left;">
<span style="font-family: inherit;">If you click on the URL, there is a big list of folders, and it does look like a mess. But for those of us in microbial genomics there are a few key folders you should know about, and probably even have mirrored on your own servers:</span></div>
<div style="text-align: left;">
</div>
<ol>
<li><a href="http://www.blogger.com/goog_980364024" style="background-color: white;"><span style="font-family: inherit;">ftp://ftp.ncbi.nih.gov/genomes/Bacteria/</span></a></li>
<li><span style="background-color: white;"><a href="http://www.blogger.com/goog_980364024"><span style="font-family: inherit;">ftp://ftp.ncbi.nih.gov/genomes/Bacteria_DRAFT/</span></a></span></li>
<li><a href="http://www.blogger.com/goog_980364024"><span style="font-family: inherit;">ftp://ftp.ncbi.nih.gov/genomes/Plasmids/</span></a></li>
<li><span style="font-family: inherit;"><a href="ftp://ftp.ncbi.nih.gov/genomes/Viruses/">ftp://ftp.ncbi.nih.gov/genomes/Viruses/</a></span></li>
<li><a href="http://www.blogger.com/goog_980364024"><span style="font-family: inherit;">ftp://ftp.ncbi.nih.gov/genomes/Fungi/</span></a></li>
<li><span style="background-color: white;"><span style="font-family: inherit;"><a href="http://www.blogger.com/goog_980364024">ftp://ftp.ncbi.nih.gov/genomes/Fungi_DRAFT/</a></span></span></li>
</ol>
<div>
Most of my work is in bacterial genomics, so I'll discuss the contents of the first four folders only. I'll leave the last two to <a href="http://fungalgenomes.org/blog/" target="_blank">an experienced mycogenomicist</a>.</div>
<h3>
</h3>
<h3>
1. Bacteria</h3>
<div>
This directory contains a folder for each <i>completed</i> bacterial genome. That is, the genome has been finished to a single DNA sequence per replicon (usually just one chromosome) and is fully annotated. There are currently around 1000 completed bacterial genomes, of which I've been involved in about 10.</div>
<div>
<br /></div>
<div>
Let's have a look at one. I chose <i>Dickeya dadantii</i> because it's a lovely sounding alliteration for a plant pathogen: <a href="ftp://ftp.ncbi.nih.gov/genomes/Bacteria/Dickeya_dadantii_3937_uid52537/" style="background-color: white;">ftp://ftp.ncbi.nih.gov/genomes/Bacteria/Dickeya_dadantii_3937_uid52537/</a></div>
<div>
<br /></div>
<div>
<div>
<span style="font-family: 'Courier New', Courier, monospace;">NC_014500.asn<span class="Apple-tab-span" style="white-space: pre;"> </span>15.9 MB<span class="Apple-tab-span" style="white-space: pre;"> </span>13/06/2012 12:11:00</span></div>
<div>
<span style="font-family: 'Courier New', Courier, monospace;">NC_014500.faa<span class="Apple-tab-span" style="white-space: pre;"> </span>1.7 MB<span class="Apple-tab-span" style="white-space: pre;"> </span>13/06/2012 12:11:00</span></div>
<div>
<span style="font-family: 'Courier New', Courier, monospace;">NC_014500.ffn<span class="Apple-tab-span" style="white-space: pre;"> </span>4.5 MB<span class="Apple-tab-span" style="white-space: pre;"> </span>19/11/2011 11:00:00</span></div>
<div>
<span style="font-family: 'Courier New', Courier, monospace;">NC_014500.fna<span class="Apple-tab-span" style="white-space: pre;"> </span>4.8 MB<span class="Apple-tab-span" style="white-space: pre;"> </span>29/09/2010 10:00:00</span></div>
<div>
<span style="font-family: 'Courier New', Courier, monospace;">NC_014500.frn<span class="Apple-tab-span" style="white-space: pre;"> </span>49.1 kB<span class="Apple-tab-span" style="white-space: pre;"> </span>29/09/2010 10:00:00</span></div>
<div>
<span style="font-family: 'Courier New', Courier, monospace;">NC_014500.gbk<span class="Apple-tab-span" style="white-space: pre;"> </span>16.7 MB<span class="Apple-tab-span" style="white-space: pre;"> </span>13/06/2012 12:11:00</span></div>
<div>
<span style="font-family: 'Courier New', Courier, monospace;">NC_014500.gff<span class="Apple-tab-span" style="white-space: pre;"> </span>1.8 MB<span class="Apple-tab-span" style="white-space: pre;"> </span>03/04/2012 03:41:00</span></div>
<div>
<span style="font-family: 'Courier New', Courier, monospace;">NC_014500.ptt<span class="Apple-tab-span" style="white-space: pre;"> </span>407 kB<span class="Apple-tab-span" style="white-space: pre;"> </span>10/03/2012 13:18:00</span></div>
<div>
<span style="font-family: 'Courier New', Courier, monospace;">NC_014500.rnt<span class="Apple-tab-span" style="white-space: pre;"> </span>7.1 kB<span class="Apple-tab-span" style="white-space: pre;"> </span>29/09/2010 10:00:00</span></div>
<div>
<span style="font-family: 'Courier New', Courier, monospace;">NC_014500.rpt<span class="Apple-tab-span" style="white-space: pre;"> </span>281 B<span class="Apple-tab-span" style="white-space: pre;"> </span>25/04/2011 10:00:00</span></div>
<div>
<span style="font-family: 'Courier New', Courier, monospace;">NC_014500.val<span class="Apple-tab-span" style="white-space: pre;"> </span>7.0 MB<span class="Apple-tab-span" style="white-space: pre;"> </span>13/06/2012 12:11:00</span></div>
</div>
<div>
<br /></div>
<div>
You can see a bunch of files, all with the same prefix (NC_104500) and a bunch of different suffixes or file extensions (gbk, gff) - some of which should be familiar to you. The NC_014500 is the RefSeq accession ID for the single chromosome of <i>Dickeya dadantii. </i>The most important files are:</div>
<div>
<ul>
<li><span style="font-family: 'Courier New', Courier, monospace;">fna</span> : FASTA file of the chromosomal sequence (think "n" = nucleotide)</li>
<li><span style="font-family: 'Courier New', Courier, monospace;">gbk</span> : Genbank file containing meta-data, sequence, and annotations</li>
<li><span style="font-family: 'Courier New', Courier, monospace;">gff</span> : GFF3 file containing annotations only (coordinates relative to the .fna file)</li>
<li><span style="font-family: 'Courier New', Courier, monospace;">faa</span> : FASTA file of the translated coding regions (proteins) annotated in the .gbk/.gff (think "aa" = amino acids)</li>
</ul>
</div>
<div>
<span style="font-family: inherit;">In terms of usefulness, the .gbk file contains (nearly) all the information that the other files contain - the .faa and .fna files are easily generated from the .gbk using BioPerl etc. If you want to get the .gbk files for <i>all</i> the finished genomes, you can download the tarball NCBI provides: </span><span style="background-color: white;"><a href="ftp://ftp.ncbi.nih.gov/genomes/Bacteria/all.gbk.tar.gz">ftp://ftp.ncbi.nih.gov/genomes/Bacteria/all.gbk.tar.gz</a></span></div>
<div>
<h3>
2. Bacteria_DRAFT</h3>
</div>
<div>
This directory contains folders for each <i>draft </i>bacterial genome. That is, the genome has been <i>de novo</i> assembled into contigs/scaffolds (eg. using Newbler for 454 data) but has not been, and probably never will be, finished. They are usually annotated, either by the submitter or automatically by NCBI, but sometimes there may be only sequences. There is about 2600 draft genomes currently.</div>
<div>
<div>
<br /></div>
<div>
Here's the contents of the <i>Thiocapsa marina str. 5811</i> genome folder - it's a purple sulphur coccus from the Mediterranean Coast if you are interested.</div>
<div>
<br /></div>
<div>
<span style="font-family: 'Courier New', Courier, monospace;">NZ_AFWV00000000.asn<span class="Apple-tab-span" style="white-space: pre;"> </span> 13.5 kB<span class="Apple-tab-span" style="white-space: pre;"> </span>03/04/2012 03:19:00</span></div>
<div>
<span style="font-family: 'Courier New', Courier, monospace;">NZ_AFWV00000000.contig.asn.tgz<span class="Apple-tab-span" style="white-space: pre;"> </span>1.7 MB<span class="Apple-tab-span" style="white-space: pre;"> </span>21/07/2012 02:13:00</span></div>
<div>
<span style="font-family: 'Courier New', Courier, monospace;">NZ_AFWV00000000.contig.faa.tgz<span class="Apple-tab-span" style="white-space: pre;"> </span>1.0 MB<span class="Apple-tab-span" style="white-space: pre;"> </span>21/07/2012 02:13:00</span></div>
<div>
<span style="font-family: 'Courier New', Courier, monospace;">NZ_AFWV00000000.contig.ffn.tgz<span class="Apple-tab-span" style="white-space: pre;"> </span>1.5 MB<span class="Apple-tab-span" style="white-space: pre;"> </span>21/07/2012 02:13:00</span></div>
<div>
<span style="font-family: 'Courier New', Courier, monospace;">NZ_AFWV00000000.contig.fna.tgz<span class="Apple-tab-span" style="white-space: pre;"> </span>1.6 MB<span class="Apple-tab-span" style="white-space: pre;"> </span>21/07/2012 02:13:00</span></div>
<div>
<span style="font-family: 'Courier New', Courier, monospace;">NZ_AFWV00000000.contig.frn.tgz<span class="Apple-tab-span" style="white-space: pre;"> </span>4.1 kB<span class="Apple-tab-span" style="white-space: pre;"> </span>21/07/2012 02:13:00</span></div>
<div>
<span style="font-family: 'Courier New', Courier, monospace;">NZ_AFWV00000000.contig.gbk.tgz<span class="Apple-tab-span" style="white-space: pre;"> </span>4.6 MB<span class="Apple-tab-span" style="white-space: pre;"> </span>21/07/2012 02:13:00</span></div>
<div>
<span style="font-family: 'Courier New', Courier, monospace;">NZ_AFWV00000000.contig.gbs.tgz<span class="Apple-tab-span" style="white-space: pre;"> </span>4.2 kB<span class="Apple-tab-span" style="white-space: pre;"> </span>21/07/2012 02:13:00</span></div>
<div>
<span style="font-family: 'Courier New', Courier, monospace;">NZ_AFWV00000000.contig.gff.tgz<span class="Apple-tab-span" style="white-space: pre;"> </span>393 kB<span class="Apple-tab-span" style="white-space: pre;"> </span>21/07/2012 02:13:00</span></div>
<div>
<span style="font-family: 'Courier New', Courier, monospace;">NZ_AFWV00000000.contig.ptt.tgz<span class="Apple-tab-span" style="white-space: pre;"> </span>119 kB<span class="Apple-tab-span" style="white-space: pre;"> </span>21/07/2012 02:13:00</span></div>
<div>
<span style="font-family: 'Courier New', Courier, monospace;">NZ_AFWV00000000.contig.rnt.tgz<span class="Apple-tab-span" style="white-space: pre;"> </span>1.5 kB<span class="Apple-tab-span" style="white-space: pre;"> </span>21/07/2012 02:13:00</span></div>
<div>
<span style="font-family: 'Courier New', Courier, monospace;">NZ_AFWV00000000.contig.rpt.tgz<span class="Apple-tab-span" style="white-space: pre;"> </span>2.5 kB<span class="Apple-tab-span" style="white-space: pre;"> </span>21/07/2012 02:13:00</span></div>
<div>
<span style="font-family: 'Courier New', Courier, monospace;">NZ_AFWV00000000.contig.val.tgz<span class="Apple-tab-span" style="white-space: pre;"> </span>1.6 MB<span class="Apple-tab-span" style="white-space: pre;"> </span>21/07/2012 02:13:00</span></div>
<div>
<span style="font-family: 'Courier New', Courier, monospace;">NZ_AFWV00000000.gbk<span class="Apple-tab-span" style="white-space: pre;"> </span> 4.7 kB<span class="Apple-tab-span" style="white-space: pre;"> </span>03/04/2012 03:19:00</span></div>
<div>
<span style="font-family: 'Courier New', Courier, monospace;">NZ_AFWV00000000.rpt<span class="Apple-tab-span" style="white-space: pre;"> </span> 257 B<span class="Apple-tab-span" style="white-space: pre;"> </span>03/04/2012 03:19:00</span></div>
<div>
<span style="font-family: 'Courier New', Courier, monospace;">NZ_AFWV00000000.val<span class="Apple-tab-span" style="white-space: pre;"> </span> 6.0 kB<span class="Apple-tab-span" style="white-space: pre;"> </span>03/04/2012 03:19:00</span></div>
</div>
<div>
<br /></div>
<div>
This folder looks a bit different to the finished genomes. It has a .gbk file, but you will notice it is quite small (4700 bytes), and if you look at it, you can see it has no sequence or annotation, only some meta-data and a reference to "<span style="font-family: 'Courier New', Courier, monospace;">WGS NZ_AFWV01000001-NZ_AFWV01000062"</span><span style="background-color: white;"><span style="font-family: 'Courier New', Courier, monospace;">.</span></span><span style="background-color: white;">This means that this genome record consist of 62 other records; one for each contig in the assembly. These are stored in the compressed tar file </span><span style="background-color: white; font-family: 'Courier New', Courier, monospace;">NZ_AFWV00000000.contig.gbk.tgz</span><span style="background-color: white;"> as follows:</span></div>
<div>
<span style="background-color: white;"><br /></span></div>
<div>
<span style="font-family: 'Courier New', Courier, monospace;"><span style="background-color: white;">% tar ztf </span><span style="background-color: white;">NZ_AFWV00000000.contig.gbk.tgz</span></span></div>
<div>
<div>
<div>
<span style="font-family: 'Courier New', Courier, monospace;">NZ_AFWV01000001.gbk</span></div>
<div>
<span style="font-family: 'Courier New', Courier, monospace;">NZ_AFWV01000002.gbk</span></div>
<div>
<span style="font-family: 'Courier New', Courier, monospace;">NZ_AFWV01000003.gbk</span></div>
<div>
<span style="font-family: 'Courier New', Courier, monospace;"><b>...</b></span></div>
<div>
<span style="background-color: white;"><span style="font-family: 'Courier New', Courier, monospace;">NZ_AFWV01000061.gbk</span></span></div>
<div>
<span style="font-family: 'Courier New', Courier, monospace;">NZ_AFWV01000062.gbk</span><br />
<span style="font-family: 'Courier New', Courier, monospace;"><br /></span></div>
</div>
<div>
So, in summary, instead of getting a nice neat single .gbk or .faa file for each replicon as you do for the completed genomes, you get a tarball of files for each assembly, with each file representing a contig in the draft genome. Any extra chromosomes or plasmids will be mixed in the bag of contigs.</div>
<h3>
3. Plasmids</h3>
</div>
<div>
The plasmids folder is not known to many people, it seems a bit hidden away frankly. It contains ~3000 completed plasmid sequences. Confusingly, ~1000 of these are <i>duplicated</i> from the Bacteria folder (as the plasmid was sequenced with its parent), while the other ~2000 are novel. Even more annoying is that the folder structure is different:</div>
<div>
<br /></div>
<div>
<div>
<span style="font-family: 'Courier New', Courier, monospace;"><span style="background-color: white;">faa/</span><span class="Apple-tab-span" style="background-color: white; white-space: pre;"> </span><span style="background-color: white;">21/07/2012 19:39:00</span></span></div>
<div>
<span style="font-family: 'Courier New', Courier, monospace;"><span style="background-color: white;">fna/</span><span class="Apple-tab-span" style="background-color: white; white-space: pre;"> </span><span style="background-color: white;">21/07/2012 19:40:00</span></span></div>
<div>
<span style="font-family: 'Courier New', Courier, monospace;"><span style="background-color: white;">gbk/</span><span class="Apple-tab-span" style="background-color: white; white-space: pre;"> </span><span style="background-color: white;">21/07/2012 19:41:00</span></span></div>
<div>
<span style="background-color: white;"><span style="font-family: 'Courier New', Courier, monospace;">...</span></span></div>
<div>
<span style="font-family: 'Courier New', Courier, monospace;"><span style="background-color: white;">plasmids.all.faa.tar.gz</span><span class="Apple-tab-span" style="background-color: white; white-space: pre;"> </span><span style="background-color: white;">43.2 MB</span><span class="Apple-tab-span" style="background-color: white; white-space: pre;"> </span><span style="background-color: white;">23/07/2012 19:43:00</span></span></div>
<div>
<span style="font-family: 'Courier New', Courier, monospace;"><span style="background-color: white;">plasmids.all.fna.tar.gz</span><span class="Apple-tab-span" style="background-color: white; white-space: pre;"> </span><span style="background-color: white;">75.1 MB</span><span class="Apple-tab-span" style="background-color: white; white-space: pre;"> </span><span style="background-color: white;">23/07/2012 19:43:00</span></span></div>
<div>
<span style="font-family: 'Courier New', Courier, monospace;"><span style="background-color: white;">plasmids.all.gbk.tar.gz</span><span class="Apple-tab-span" style="background-color: white; white-space: pre;"> </span><span style="background-color: white;">199 MB</span><span class="Apple-tab-span" style="background-color: white; white-space: pre;"> </span><span style="background-color: white;">23/07/2012 19:43:00</span></span></div>
</div>
<div>
<span style="background-color: white;"><span style="font-family: 'Courier New', Courier, monospace;">...</span></span></div>
<div>
<h3>
<div style="font-size: medium; font-weight: normal;">
Now we have a folder for each <i>file extension, </i>which each contains 3000 files. So the files for a particular plasmid are spread out over multiple folders. Fortunately they provide compressed tar files of the whole archive to download directly: <span style="background-color: white; font-family: 'Courier New', Courier, monospace;">plasmids.all.gbk.tar.gz</span></div>
</h3>
<h3>
4. Viruses</h3>
</div>
<div>
Some of you may be wondering why I am including Viruses in this story. Well, some viruses infect Bacteria too - they are called <a href="http://en.wikipedia.org/wiki/Bacteriophage" target="_blank">bacteriophage</a>. There are ~3000 folders in the Viruses division, but not all of them are bacteriophage. A simple grep for "<i>phage</i>" suggests ~600 are bacterial viruses. The folder structure is the same as for the finished Bacteria genomes.</div>
<div>
<br /></div>
<div>
It is important to realise that most of these virus sequences are natively dsDNA and will also appear integrated into the chromosomal DNA of many of the entries in Bacteria and Bacteria_DRAFT. </div>
<div>
<br /></div>
<div>
<br /></div>
<div>
<br /></div>Torsten Seemannhttp://www.blogger.com/profile/12241185247897084810noreply@blogger.com22